JNCI Journal of the National Cancer Institute

Journal of the National Cancer Institute Advance Access published online on November 13, 2007
JNCI Journal of the National Cancer Institute, doi:10.1093/jnci/djm208

This Article Abstract FREE Full Text (PDF) All Versions of this Article: 99/22/1668    most recent djm208v1 Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Add to My Personal Archive Download to citation manager Request Permissions Google Scholar Articles by Tao, Q. Articles by Lotan, R. Search for Related Content PubMed PubMed Citation Articles by Tao, Q. Articles by Lotan, R. Related Collections Editorial about this Article Related Article in JNCI Social Bookmarking          What's this?

© The Author 2007. Published by Oxford University Press.

ARTICLES

Identification of the Retinoic Acid–Inducible Gprc5a As a New Lung Tumor Suppressor Gene

Qingguo Tao, Junya Fujimoto, Taoyan Men, Xiaofeng Ye, Jiong Deng, Ludovic Lacroix, John L. Clifford, Li Mao, Carolyn S. Van Pelt, J. Jack Lee, Dafna Lotan, Reuben Lotan

Affiliations of authors: Departments of Thoracic/Head and Neck Medical Oncology (QT, JF, TM, XY, JD, LL, LM, DL, RL), Clinical Cancer Prevention (JLC), Veterinary Medicine and Surgery (CSVP), and Biostatistics (JJL), The University of Texas M. D. Anderson Cancer Center, Houston, TX

Correspondence to: Reuben Lotan, PhD, Department of Thoracic/Head and Neck Medical Oncology, The University of Texas M. D. Anderson Cancer Center, Houston, TX 77030 (e-mail: rlotan{at}mdanderson.org).

	ABSTRACT

Top Abstract Context and Caveats Materials and Methods Results Discussion Funding References Notes

 
Background: Lung cancers develop via multiple genetic and epigenetic changes, including inactivation of tumor suppressor genes. We previously cloned human G protein–coupled receptor family C type 5A (GPRC5A), whose expression is suppressed in some human lung carcinoma cells, and its mouse homolog Gprc5a.

Methods: We generated Gprc5a knockout mice by homologous recombination and studied their phenotype by macroscopic observation and microscopic histologic analysis of embryos and lungs of 1- to 2-year-old mice. GPRC5A mRNA expression was analyzed by reverse transcription–polymerase chain reaction in surgical specimens of 18 human lung tumors and adjacent normal tissues and by analyzing previously published data from 186 lung tumor tissues of a variety of histologic types and 17 normal lung samples. Human embryonic kidney, human non–small-cell lung cancer, and mouse lung adenocarcinoma cells were transfected with a GPRC5A expression vector or a control vector, and colony formation in semisolid medium was assayed. Statistical tests were two-sided.

Results: Homozygous knockout mice developed many more lung tumors at 1–2 years of age (incidence: 76% adenomas and 17% adenocarcinomas) than heterozygous (11% adenomas) or wild-type (10% adenomas) mice. Human GPRC5A mRNA levels were lower in most (11 of 18 [61%]) human lung tumors than in adjacent normal tissues. The mean GPRC5A mRNA level in adenocarcinoma (n = 139), squamous cell carcinoma (n = 21), small-cell lung cancer (n = 6), and carcinoid (n = 20) tissues was 46.2% (P = .014), 7.5% (P<.001), 5.3% (P<.001), and 1.8% (P<.001), respectively, that in normal lung tissues (n = 17) GPRC5A transfection suppressed colony formation in semisolid medium of immortalized human embryonic kidney, human non–small-cell lung cancer, and mouse lung adenocarcinoma cells by 91%, 91%, and 68%, respectively, compared with vector controls (all P<.001).

Conclusions: Gprc5a functions as a tumor suppressor in mouse lung, and human GPRC5A may share this property. The Gprc5a-deficient mouse is a novel model to study lung carcinogenesis and chemoprevention.

---

CONTEXT AND CAVEATS Top Abstract Context and Caveats Materials and Methods Results Discussion Funding References Notes   Prior knowledge Multiple genetic and epigenetic changes contribute to the development of lung cancer. The expression of G protein–coupled receptor family C type 5A (GPRC5A) is suppressed in some human lung cancers. Study design A novel Gprc5a knockout mouse model, comparison of GPRC5A expression in human lung cancer and normal lung tissue, and in vitro colony formation assays of human and mouse tumor cell lines expressing exogenous human GPRC5A. Contributions Homozygous Gprc5a knockout mice developed more lung tumors during 1–2 years than heterozygous or wild-type mice. GPRC5A expression was lower in most of the lung tumors than in normal lung tissues. Exogenous GPRC5A expression reduced colony formation in tumor cell lines. Implications Gprc5a functions as a lung tumor suppressor in the mouse. The human GPRC5A may also function as a tumor suppressor in human lung cancer. Limitations Other genetic or epigenetic changes may have occurred in the mouse model. Mice were not exposed to carcinogens or proinflammatory agents, which are important in the development of human lung cancer.

 

Retinoids are a group of vitamin A analogs (e.g., retinoic acid [RA]) that regulate embryogenesis, development, differentiation, and tumorigenesis by modulating gene expression (1–5). Some retinoids have shown promise as chemopreventive and therapeutic agents (2,3). Therefore, the identification and functional analysis of RA target genes may improve the understanding of the mechanism of action of retinoids as well as the mechanisms that influence development and carcinogenesis.

We previously cloned an RA-inducible gene, RAIG1 (synonyms: retinoic acid–induced 3 [RAI3], G protein–coupled receptor family C group 5 member A [GPRC5A]; gene accession number NM003979), whose expression is suppressed in some non–small-cell lung cancer (NSCLC) and head and neck squamous cell carcinoma cell lines and is induced by RA in these lines (6). The gene encodes a protein with seven transmembrane domains characteristic of all G protein–coupled receptors (GPCRs) (6). RAI3 has been assigned to the GPCR family C based on its sequence homology to glutamate receptors, which are called metabotropic because they are indirectly linked with ion channels on the plasma membrane through signal transduction mechanisms (7). The GPRC5A gene is located on chromosome 12p13-p12.3, and its promoter contains an RA response element to which nuclear retinoid receptors (RAR and RXR) can bind as heterodimers, enhancing RA-dependent gene transcription (6,8). Three RA-inducible genes related to GPRC5A, referred to as GPRC5B (RAIG2), GPRC5C (RAIG3), and GPRC5D, have been subsequently identified and found to exhibit distinct tissue distribution, with GPRC5A being predominantly expressed in the lung (6), GPRC5B in the brain, GPRC5C in various tissues, and GPRC5D in skin (9–11). Homologous genes in the mouse genome include Rai3 or Gprc5a (8,12), Gprc5b and Gprc5c (13), and Gprc5d (10,11). Mouse Gprc5a (gene symbol BC036173) is located on chromosome 6 G1 (8), which is the syntenic locus of the human GPRC5A gene 12p13-12.3.

In light of the suppression of GPRC5A expression in human NSCLC and head and neck squamous cell carcinoma cell lines and its induction by RA in these cells (6), we hypothesized that the protein encoded by this gene might mediate retinoid-regulated physiologic and pathologic processes, including suppression of carcinogenesis. To test this hypothesis, we transfected human and mouse lung adenocarcinoma cell lines and immortalized human embryo kidney cells with a GPRC5A expression vector and measured colony formation in semisolid medium. To gain more information on the function of Gprc5a in vivo, we generated Gprc5a knockout mice and compared their phenotype with that of their wild-type littermates.

	Materials and Methods

Top Abstract Context and Caveats Materials and Methods Results Discussion Funding References Notes

 
Construction of the Gprc5a Targeting Vector

We used a genomic clone containing the entire Gprc5a gene (mouse chromosome 6, Locus NC_000072.5; nucleotides 135015708–135034721) that we had isolated previously (8) from a commercially available 129sv mouse bacterial artificial chromosome (BAC) library (Invitrogen, Carlsbad, CA). The targeting construct was designed to replace the entire coding sequence of the endogenous Gprc5a gene with the LacZ and Neo genes after homologous recombination. The targeting construct, generated from selected fragments that were derived from the BAC clone, contained a 4-kb fragment including intron I, which was derived using the restriction enzyme KpnI; a 0.3-kb polymerase chain reaction (PCR) product (XhoI–XhoI) containing a 3' splicing acceptor and a noncoding exon 2 sequence; and a 3-kb SacII–SalI fragment containing partial exon 4 and 3' flanking sequences. In addition, the construct included a 4.6-kb (XhoI–BamHI) fragment from a plasmid containing the LacZ gene (Promega, Madison, WI) and a 1.7-kb loxP-flanked neomycin resistance gene (14), which was obtained from the University of Texas M. D. Anderson Cancer Center's Transgenic Mouse Core Facility. All of these fragments were cloned into the vector pKO-NTKV-1901 (Stratagene, La Jolla, CA), which contains the herpes simplex virus thymidine kinase expression cassette for negative selection.

Transfection of Embryonic Stem Cells and Generation of Gprc5a-Deficient Mice

Embryonic stem (ES) cells that had been previously isolated from 129sv mice were recovered from stocks frozen in liquid nitrogen at the University of Texas M. D. Anderson Cancer Center's Transgenic Mouse Core Facility and were cultured at this facility using methods described by Wurst and Joyner (15). Twenty micrograms of Not1-linearized Gprc5a gene-targeting construct were electroporated into 1 x 10⁷ ES cells. After 10 days of selection with 350 µg/mL of Geneticin (G418) and 200 µM 1-(2'-deoxy-2'-fluoro--D-arabinofuranosyl)-5-iodouracil, 200 transfected ES cell colonies were isolated and genotyped by Southern blotting and PCR using the primers and probes described below. Homologous recombination, indicating successful targeting, was detected in 10 of these clones. Three of these ES cell clones were then injected into blastocysts that were derived from C57BL/6 (B6) mice and transferred into pseudopregnant B6 females. Two of these ES cell clones gave rise to chimeric mice. Seven male mice from the resulting chimeric progeny were mated with B6 females (n = 50) for germline transmission of the Gprc5a-targeted alleles in the B6;129sv F1 progeny (n = 396). Heterozygous F1 mice (n = 100) were inbred to generate F2 progenies (n = 400). All mice were thereafter in a B6;129sv mixed genetic background. All of the mice were bred and maintained according to a protocol approved by the University of Texas M. D. Anderson Animal Care and Use Committee at the institution's specific pathogen-free mouse facility, which is approved by the American Association for Accreditation of Laboratory Animal Care and is operated in accordance with current regulations and standards of the US Department of Agriculture and the Department of Health and Human Services.

Genotyping of ES Cells and Mouse Progeny

Both Southern blotting and PCR were used to screen electroporated ES cells (n = 200), whereas only PCR was used for genotyping F1 (n = 396) and F2 (n = 400) progeny. The tips of the tails (about 5 mm) from each 2- to 3-week-old mouse were excised and used to isolate DNA for PCR genotyping. Genomic DNA (5 µg) was digested with BamHI, separated on 1% agarose gels, and transferred to a Hybond-N+ nylon transfer membrane (Amersham, Piscataway, NJ). The membranes were hybridized with a 5' probe that had been derived by PCR from intron 1 using the primers, 5' forward (F) CTCATGGATGAGAGCCCATT (135020043–135020062) and 5' reverse (R) GGCTAGCCTGGAACACAGAG (135020739–135020758), and the 3' probe from the flanking sequence using the primers, 5' forward (F) GCACAAGATTGTGAGCAGGA (135038019–135038038) and 5' reverse (R) AACCTGTGTGGTGGGAAGAG (135038642–135038661). The PCR conditions were as follows: 94 °C for 3 minutes; 28 cycles of 94 °C for 30 seconds, 58 °C for 30 seconds, 72 °C for 45 seconds; and 72 °C for 5 minutes. The 5' probe hybridized to an 8-kb fragment from the wild-type genome and a 12-kb fragment from the mutant genome, whereas the 3' probe hybridized to a 10-kb fragment from wild-type genome and a 6.5-kb fragment from the mutant genome. For PCR screening of DNA from ES cells and mouse tail, the primers 5' forward (F) wt (AGCATGGGAGCTTACCAGTGG), 5' reverse (R) wt (TACCTGGAATCCAGGTCTGAG), and 5RLacZ (TCAGGAAGATCGCACTCCAGC) were used under the same PCR conditions. The PCR products for wild-type and mutant genomes were 300 and 600 bp, respectively. We screened 200 ES clones using Southern blotting, and ES clones that appeared to exhibit clearly visible bands of the expected size were further analyzed by PCR for confirmation.

Analysis of Gprc5a, Gprc5b, and Gprc5c mRNAs in Lung Tissue From Gprc5a (+/+), (+/–), and (–/–) Mice by Duplex Reverse Transcription–PCR

Total RNA was extracted from 100 mg wet weight lung tissue (one sample per mouse) from 3- to 4-month-old mice using Tri-Reagent (Molecular Research Center, Cincinnati, OH) according to the manufacturer's instructions. The mRNA was reverse transcribed to cDNA using the RETROscript first-strand synthesis kit (Ambion, Austin, TX) and amplified by PCR using gene-specific primers and SuperTaq Plus (Ambion) according to the manufacturer's instructions. The sequences of gene-specific primers used were as follows: Gprc5a (accession number NM_181444) reverse, 5'-ACAGACCTTGTCTACTCCAG-3'; Gprc5a forward, 5'-GACACACTCTATGCACCTTATTC-3'; Gprc5b (accession number AF378831) reverse, 5'-CTGACGTTTGCCTTCATCATC-3'; Gprc5b forward, 5'-CCTCAAGAAAGACACAGCCAG-3'; Gprc5c (NM_147217) reverse, 5'-TCGCCAACATGGACTTTGTCA-3'; Gprc5c forward, 5'-TTAGTCCCACACGTAGCG-3'. -Actin QuantumRNA Internal Standards (Ambion proprietary sequences) were used as primers for amplification of -actin (control) in duplex PCR as described above. The analyses were performed in triplicate.

Northern Blotting to Measure Gprc5a mRNA Expression in Normal Adult Mouse Tissues and Mouse Embryos

Total RNA (10 µg) from mouse heart, brain, lung, liver, kidney, testis, thymus, spleen, and ovary (Ambion) was separated by electrophoresis in agarose gels and transferred to membranes as above. Two membranes containing poly(A)+ RNA from embryos at days 7, 11, 15, and 17 postcoitus (pc) were purchased from Clontech (La Jolla, CA). Northern blotting analysis was performed as follows: a cDNA probe generated by EcoRI restriction digestion of a pCRII vector (Invitrogen) containing Gprc5a cDNA was labeled with [³²P]dCTP (ICN, Costa Mesa, CA) to a specific activity of approximately 2 x 10⁹ dpm/mg with the Prime It II random primer labeling kit (Strategene). Membranes were prehybridized in Rapid-hyb buffer (Amersham) at 68 °C for 1 hour, followed by hybridization with the cDNA probe at 68 °C overnight. Membranes were washed twice with 2x standard saline citrate (0.3 M sodium chloride and 0.03 M sodium citrate)/0.1% sodium dodecyl sulfate (SDS) for 15 minutes at room temperature and twice with 0.1x standard saline citrate/0.1% SDS for 20 minutes at 68 °C and then exposed to X-Omat film (Eastman Kodak Co, Rochester, NY) for various times. Two independent experiments with one membrane each were performed.

In Situ Hybridization to Detect Gprc5a mRNA in Wild-Type Mouse Lung, Heart, Brain, and Kidney Tissues

The presence of Gprc5a mRNA in formalin-fixed, paraffin-embedded sections of mouse lung and kidney was analyzed by nonradioactive in situ hybridization according to a previously established protocol (16). A digoxigenin-labeled RNA probe was prepared from a cDNA fragment (100–1632 bp) that includes most of the open-reading frame. This fragment was cloned into the pCRII vector (Invitrogen) with the 5' end oriented to the Sp6 promoter and the 3' end to the T7 promoter. The template for the antisense probe was a 763- to 1632-bp fragment (BamHI digest), and T7 RNA polymerase was used for transcription. The sense probe template was a 100- to 1168-bp fragment (ApaI digest), and Sp6 RNA polymerase was used for transcription. The quality and specificity of the digoxigenin-labeled probes were determined by northern blotting, and the specificity of the binding of the antisense riboprobes was verified by using sense probes as controls. Three independent experiments were performed, each with duplicate sections. All sections were stained on the same day with the same reagents to ensure a reliable comparison.

Staining to Detect Gprc5a Promoter Activity and Histologic Analysis of Embryo and Adult Lungs

5-Bromo-4-chloro-3-indolyl--D-galactopyranoside X-gal staining for -gal expression and activity was performed as described by Ausubel et al. (17). Briefly, whole embryos (n = 4) collected at days 13.5 pc and 17 pc from pregnant Gprc5a wild-type and knockout females, along with lungs and intestines excised from two 3-month-old mice, were fixed at room temperature for 30 minutes in a solution containing 0.2% glutaraldehyde, 1.2% formaldehyde, 5 mM EGTA, 100 mM sodium phosphate, pH 8.0; rinsed in wash buffer (2 mM MgCl₂, 0.01% sodium deoxycholate, 0.02% Nonidet P-40, 100 mM phosphate, pH 8.0); and incubated in staining solution [1 mg/mL X-gal, 5 mM K₄Fe(CN)₆, 5 mM K₃Fe(CN)₆ in sodium phosphate buffer, pH 8.0] overnight at 37 °C. Embryos and adult lungs and intestines were then dehydrated in a series of graded methanol solutions and cleared in 1:1 glycerol/alcohol. For histologic analysis, lungs from embryos (n = 4) and adult mice (n = 2) and intestines from adult mice (n = 2) were isolated, fixed in 10% formalin, embedded in paraffin, sectioned, counterstained with Nuclear Fast Red (Vector Laboratories, Inc, Burlingame, CA), dehydrated, and mounted with Permount.

Monitoring Mice for Altered Phenotype and Tumor Development

B6;129sv F1 heterozygous mice (n = 100) were mated, and their progeny (n = 400) were genotyped as embryos (n = 20) and/or within 3 weeks after birth (n = 400) by analysis of DNA extracted from an excised tail tip sample. The mice were weaned after 3 weeks, and males were separated from females at that time. The frequency of each of the genotypes Gprc5a (+/+), (+/–), and (–/–) among the progeny was determined by PCR as described above. The embryos were analyzed for gross changes, and lungs of stage 13.5 pc and 17 pc embryos were fixed in formalin, embedded in paraffin as above, and used to prepare five sections (5-µm each), which were analyzed for histologic changes by hematoxylin and eosin staining. Mice (n = 400) bred as described above were maintained (five per cage) at the University of Texas M. D. Anderson Cancer Center pathogen-free mouse facility. The mice were monitored daily for signs of morbidity (e.g., ruffled hair, reduced weight gain, or weight loss) and were killed by CO₂ inhalation when 1) signs of morbidity required that they be killed, 2) a littermate had shown signs of morbidity and the presence of lung cancer at necropsy, or 3) they had reached the age of 24 months. The mice were dissected, and organs in the thoracic and abdominal cavities were examined for the presence or absence of tumors by visual inspection. The lungs of all mice were resected, and suspected tumors were excised. Both lungs and tumors were then fixed separately in neutral-buffered formalin and embedded in paraffin blocks. Sequential segments, a few millimeters thick, were cut and re-embedded in a single paraffin block, which was used for preparation of 4-µm sections that were then placed on microscope slides and stained with hematoxylin and eosin. Diagnosis of adenoma and carcinoma followed histologic criteria described previously (18,19).

Antibodies

Rabbit polyclonal antibodies to human surfactant Protein A (SP-A, Santa Cruz Biotechnologies, Santa Cruz, CA), human surfactant Protein B (SP-B, Chemicon International, Inc, Temecula, CA), human prosurfactant Protein C (proSP-C, Chemicon), human Clara Cell secretory protein (CCSP; Upstate USA, Inc, Charlottesville, VA), and mouse involucrin (kindly provided by Dr Fiona Watt, London, U.K.) were used for immunohistochemical analyses. Mouse monoclonal antibodies against a myc epitope peptide tag (Upstate) and rabbit polyclonal anti–-actin antibodies (Sigma, Chemical Co., St Louis, MO) were used for immunoblotting. The synthetic peptide (C)SPYNDYEGRKGDS-COOH, corresponding to amino acids 344–356 in the Gprc5a C-terminus, was linked covalently to keyhole limpet hemocyanin via the first cystein residue, and polyclonal antipeptide antibodies were prepared in rabbits as a custom service by Zymed Laboratories (South San Francisco, CA). Sera were confirmed to contain high titer antibodies against the specific peptide using an enzyme-linked immunosorbent assay. To remove nonspecific rabbit anti-mouse antibodies, we preadsorbed the antiserum using Sepharose 4B beads covalently conjugated with the total cell protein fraction from homogenates of lungs of Gprc5a (–/–) mice, which had been extracted with a mild detergent (Tween 20; Sigma Chemical Co).

Immunohistochemistry

A modification of the immunoglobulin enzyme bridge technique (avidin–biotin peroxidase complex method) was used as previously described (20). Briefly, normal lung and lung tumor tissue samples from all of the knockout mice that developed adenoma or adenocarcinoma were fixed in formalin, embedded in paraffin, and used to prepare sections (4-µm thickness), which were mounted on poly-L-lysine–coated slides. The sections were deparaffinized, hydrated, and incubated in peroxidase blocking reagent (DAKO, Carpenteria, CA) to block endogenous peroxidase activity. Sections to be analyzed for SP-A, SP-B, proSP-C, involucrin, and Gprc5a were subjected to antigen retrieval using Target Retrieval Solution (DAKO), whereas those to be analyzed for CCSP were incubated with proteinase K. The sections were washed in Tris-buffered saline (TBS; 50 mM Tris, pH 7.6, and 0.15 M NaCl) and incubated overnight at 4 °C with rabbit polyclonal antibodies (see above) diluted in TBS as follows: SP-A, 1:50; SP-B, 1:500; proSP-C, 1:100; CCSP and involucrin, 1:1000. Subsequently, the sections were washed in TBS and incubated with biotinylated goat anti-rabbit immunoglobulins (undiluted Biotinylated Link Universal solution; DAKO). The sections were then incubated with avidin–biotin peroxidase complex (DAKO) and developed with 3,3-diaminobenzidine. Finally, the sections were rinsed in distilled water, counterstained with hematoxylin (DAKO), and mounted on microscopy sides.

Analysis of K-Ras Mutations in Tumors From Gprc5a Knockout Mice by PCR-Direct Sequencing

DNA was isolated from formalin-fixed, paraffin-embedded lung tumors from five Gprc5a (–/–) mice. PCR primers for K-Ras were as follows: exon 1 (covering codons 12 and 13), forward, 5'-ATGACTGAGTATAAACTTGTG-3', reverse, 5'-TCGTACTCATCCACAAAGTG-3, and exon 2 (covering codon 61), forward, 5'-GGACTCCTACAGGAAACAAGTAGTA-3', reverse, 5'-ATAATGGTGAATATCTTCAAATG-3'. PCR conditions were the same as described above for genotyping. PCR products were purified using a PCR purification kit (Qiagen Inc., Valencia, CA) and sequenced at the University of Texas M. D. Anderson DNA Sequencing Core Facility. One sample from one tumor was analyzed for each of five mice.

Analysis of GPRC5A mRNA in Paired Human Normal and Tumor Lung Tissues by Duplex RT–PCR

Surgical specimens were obtained from 18 patients with early-stage NSCLC (nine adenocarcinomas and nine squamous cell carcinomas) who underwent surgical resection at the Department of Thoracic and Cardiovascular Surgery at the University of Texas M. D. Anderson Cancer Center (21). Signed informed consent was obtained from each patient to allow the use of biological materials for biomarker studies under a protocol approved by the University of Texas M. D. Anderson's Institutional Review Board. Freshly frozen primary lung cancer samples and adjacent normal lung samples were subjected to mRNA extraction as above, and reverse transcription (RT)–PCR was performed using the following primers: forward, 5'- GTGGAGAACAGAGCCTACTCT-3', and reverse, 5'-TGAGCTCAGATGACCAGACCT-3'. The conditions of RT–PCR were the same as described above. Tumor and normal samples were tested in triplicate.

Analysis of GPRC5A Expression in Human Lung Carcinomas Using Raw Data in a Public Database

Analysis of GPRC5A expression in 186 human lung carcinomas and 17 normal lung samples was based on available raw data published as supporting information by Bhattacharjee et al. (22). We extracted the expression value of GPRC5A from this dataset [included as Affymetrix probe number 33730_at and listed as "retinoic acid induced 3" in a DatasetA_12600gene_floor_Fig1order.xls file (22)]. Clinicopathologic features are available in the Supporting_Sample_Data_Information_File (22). The values used for gene expression were rescaled and negative values were floored to 0, as described by the authors (22).

Cell Culture

Human embryonic kidney 293F (HEK293F) cells that were generated by the transformation of normal cells using human adenovirus 5 sheared DNA (23) were obtained from J. A. Roth's laboratory (M. D. Anderson Cancer Center). The human NSCLC cell line H1792 was obtained from A. Gazdar (University of Texas Southwestern, Dallas, TX). The mouse lung adenocarcinoma MDA1478 cell line was derived in our laboratory from a lung adenocarcinoma that had arisen in a Gprc5a (–/–) mouse, whose care was in accordance with institutional guidelines, using a modification of the method described by Xu et al. (24). The tumor was excised, washed in phosphate-buffered saline (PBS, 137 mM sodium chloride, 2.7 mM potassium chloride, 10 mM phosphate buffer, pH 7.4) containing antibiotics, and cut into 1- to 3-mm-sized pieces, which were placed in Primaria petri dishes (Falcon Becton Dickinson Labware, Franklin Lakes, NJ) with 1 mL of AmnioMax-C100 medium (GIBCO BRL, Grand Island, NY) and allowed to attach and grow. The same medium was replaced three times a week. When epithelial outgrowths reached 80% confluency, cells were incubated for 3 minutes with cold 0.05% trypsin, 2 mM EDTA in Ca⁺²-free, Mg ⁺²-free PBS (CMF-PBS), and fibroblasts were selectively removed by gentle pipetting. The epithelial cells that remained attached were removed by an additional 5-minute incubation with 0.25% trypsin in 2 mM EDTA in CMF-PBS and subcultured in Dulbecco's modified Eagle's minimum essential medium mixed 1:1 with Ham's F12 medium supplemented with 10% fetal calf serum. This medium was also used for HEK293F and H1792 cells.

Immunofluorescence

NSCLC H1792, HEK293F, and MDA1478 cells (n = 2 x 10⁵) were allowed to attach onto coverslips overnight, rinsed with PBS, fixed in formaldehyde, and permeabilized with 1% Triton X-100 in PBS (PBST). After preblocking with 5% bovine serum albumin (Sigma) in PBS, cells were incubated with mouse monoclonal myc-tag antibody (Upstate, 1:500 in PBST), washed with PBS, and incubated with fluorescein isothiocyanate (FITC)–conjugated rabbit anti-mouse (Molecular Probes, Eugene, OR, diluted 1:1500 in PBS). Nuclei were then stained with 4',6-diamidino-2-phenylindole (DAPI, Sigma). Three independent experiments were performed, in each of which, 100 cells were analyzed in five different microscopic fields at 40x magnification using a Nikon fluorescence microscope. Images were captured with a Nikon camera, and images of DAPI and FITC staining were overlayed.

Preparation of myc Epitope–Tagged GPRC5A Expression Vector and Stable Transfection of Human and Mouse Lung Cancer Cells

A myc-tagged GPRC5A expression vector was generated by attaching the myc tag sequence EQKLISEEDL to the C-terminus of GPRC5A (accession code NM_003979) by PCR cloning, using the following primers: 5' (with BamHI site), 5'GCACGGTACCGCCACCATGGCTACAACAGTCCCTGATGGTTGCGTCCTA3', and 3' (with XhoI site), 5'GAGCCTCGAGCTACAGATCCTCTTCAGAGATGAGTTTCTGCTCGCTGCCCTCTTTCTTTACTTCATAGTCTTTGTA3'. The PCR product was digested with the restriction enzymes BamHI and XhoI and then inserted in the corresponding site in the pcDNA3.1(+) vector, which contains a human cytomegalovirus immediate-early promoter for high-level expression in a wide range of mammalian cells and a neomycin resistance gene (Invitrogen).

HEK293F, H1792, and MDA1478 cells (1 x 10⁶) were transfected with control plasmid (pcDNA3.1+) or GPCR5A-myc expression vector in the same plasmid using FuGENE 6 (a nonliposomal multicomponent lipid-based transfection reagent with low toxicity) according to the manufacturer's instructions (Roche Diagnostics, Indianapolis, IN). Stable transfectants were isolated by growing the cells in the presence of the antibiotic Geneticin for selection, according to the manufacturer's instructions (Invitrogen). Two independent experiments were performed, each with at least two clones being generated.

Immunoblotting Analysis of GPCR5A Expression in Transfected Cells

After transfection and selection for neomycin resistance, HEK293F, H1792, and MDA1478 cells were washed in PBS and lysed by suspension in a buffer containing 50 mM Tris–HCl, pH 8.0, 150 mM NaCl, 0.1% SDS, 1% Nonidet P-40, 1 mM phenylmethylsulfonyl fluoride, 5 µg/mL aprotinin, and 5 µg/mL leupeptin. Lysates were incubated on ice for 15 minutes, and cell debris was removed by centrifugation at 13000 x g for 30 minutes at 4 °C. The supernatants were collected, and their protein concentrations were determined using a Protein Assay Kit (Bio-Rad, Hercules, CA). Samples containing 20–40 µg of protein were subjected to electrophoresis through 10% polyacrylamide slab gels in the presence of 0.1% SDS and transferred to nitrocellulose membranes (Bio-Rad) by electroblotting. After transfer, membranes were immersed in blocking solution (5% nonfat milk in PBS, 0.5% Tween-20) at room temperature for 1 hour and then incubated with mouse anti-myc tag monoclonal antibodies diluted 1:500 in blocking solution overnight at 4 °C with rocking. Membranes were washed three times with PBS containing 0.5% Tween-20 and incubated with rabbit anti-mouse antibodies (horseradish peroxidase–conjugated) diluted at 1:8000 in blocking solution at room temperature for 1 hour. Membranes were then washed three more times with washing buffer, and antibody binding was detected using the enhanced chemiluminescence system (Amersham) and Hyperfilm MP (Amersham). Four independent experiments were performed, each in duplicate.

Analysis of Anchorage-Independent Colony Formation in Semisolid Medium

Mouse MDA1478 (Gprc5a–/–) lung adenocarcinoma cells (0.5 x 10⁴) and human NSCLC H1792 and human embryo kidney HEK293F cells (both at 1 x 10⁴) stably transfected with vector control and transfected with myc-tagged GPRC5A (GPRC5A-myc) were suspended in 0.2 mL of Matrigel (Collaborative Biomedical Products, Becton Dickinson Labware, Bedford, MA) diluted 1:1 (vol/vol) with growth medium supplemented with 10% fetal bovine serum. Cell suspensions were then placed on top of a previously cast semisolid layer of 0.2 mL of 1% low–melting temperature agarose in growth medium in each well of a 24-well plate. Colonies were allowed to form over a period of 2 weeks at 37 °C in a humidified CO₂ incubator. Colonies in four microscopic fields were then counted under an inverted microscope at 40x magnification and photographed. Aggregates of 50 or more cells were considered to be colonies. The means and 95% confidence intervals (CIs) of the number of colonies in four microscopic fields were calculated. Two independent experiments were performed, each in triplicate.

Statistical Methods

Descriptive statistics were used to summarize the data. A two-sided z test based on arcsine transformation was applied to compare the numbers of tumors across the different Gprc5a genotypes. GPRC5A expression values in various groups of tumor tissues, including adenocarcinoma, squamous cell carcinoma, small-cell lung cancer, and carcinoid tissues, were compared with those of normal tissues using moderated t statistics based on the hierarchical linear model and empirical Bayes method (25). Association of GPRC5A expression with adenocarcinoma differentiation was studied using Spearman's rank correlation coefficient and linear regression analysis. Statistical analysis was carried out by applying the limma function in the R package (26). P values were adjusted using the Benjamini and Hochberg method (27) to control the false discovery rate for multiple comparisons using the 3312 most variable transcript sequences [from DatasetA_3312genesetdescription_sd50.xls (22)]. All P values were two-sided, and P values less than .05 were considered statistically significant.

	Results

Top Abstract Context and Caveats Materials and Methods Results Discussion Funding References Notes

 
Preferential Expression of Gprc5a in Mouse Lung

A 2.2-kb Gprc5a transcript was abundant in lung tissues of adult wild-type mice but undetectable in other tissues (Fig. 1, A). Gprc5a mRNA was detected in day 15 mouse embryos, and a marked increase was observed in day 17 embryos (Fig. 1, B). Gprc5a mRNA was detected in the epithelial cells lining the bronchioles and in alveolar cells using antisense probe (Fig. 1, C) but not sense probe (Fig. 1, D). The antisense probe did not detect Gprc5a mRNA in kidney sections (Fig. 1, E) or in sections of heart and brain (data not shown).

View larger version (78K): [in this window] [in a new window] [Download PowerPoint slide]   Fig. 1 Comparison of Gprc5a mRNA levels in adult mouse tissues and in mouse embryos at four stages of growth. A) Northern blotting analysis of total RNA extracted from the indicated adult mouse tissues using a Gprc5a probe. B) Northern blotting analysis of total RNA extracted from mouse embryos on the indicated days. Membranes in A and B were reprobed for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression as a control for loading and transfer. The images shown are representative of three independent experiments with one membrane each, which yielded similar results. C–E) Detection and localization of Gprc5a mRNA in adult lung tissue (C and D) and kidney (E) by in situ hybridization analysis using digoxygenin-labeled antisense (C and E) or sense (control) (D) probes. In panel C, bronchiolar epithelial cells (Br) are separated from alveoli (Al) by a broken white line. Arrows point to some cells expressing Gprc5a mRNA (large arrows point to epithelial cell lining the bronchiole, and small arrows point to cells forming the alveoli). Three independent experiments, each with duplicate sections, were performed, with results similar to those shown in the images. Scale bars = 100 µm in panels C–E.

 
Generation of Mice With Heterozygous or Homozygous Deletion of Gprc5a

Deletion of the Gprc5a gene using a targeting strategy (Fig. 2, A) was achieved in 10 of 200 transfected strain 129sv ES cell clones (Fig. 2, B). Two of three independently targeted ES clones gave rise to chimeric mice that were able to effect germline transmission of the disrupted allele when bred to B6 females. Heterozygote-by-heterozygote breeding produced offspring that were wild-type (+/+), heterozygous (+/–), or homozygous (–/–) for Gprc5a (Fig. 2, C) in a Mendelian distribution. Gprc5a mRNA level was lower in lungs of (+/–) mice than (+/+) mice and not detected in (–/–) mice (Fig. 2, D), whereas the mRNAs for the related Gprc5b and Gprc5c genes, which were not targeted, were detected at low levels in mice of all three genotypes.

View larger version (47K): [in this window] [in a new window] [Download PowerPoint slide]   Fig. 2 Targeted disruption of the murine Gprc5a gene. A) Schematic representation of Gprc5a gene knockout constructs. The wild-type allele (top), the targeting construct (middle), and the mutant genome (bottom) are shown. The targeting vector was designed such that the coding exon 2, intron 2, exon 3, intron 3, and exon 4 are replaced with the bacterial beta-galactosidase (LacZ) gene and loxP-flanked neomycin resistance gene (L-Neo-L); the thymidine kinase (TK) gene was included for negative selection. The locations of the two external probes (3'and 5') used to confirm correct targeting events and the size of the diagnostic restriction fragments for Southern blot are indicated. The locations of the three primers (5Fwt, 5Rwt, and 5RlacZ) used for genotyping are also indicated (see "Materials and Methods"). B) Southern blot analysis of genomic DNA isolated from selected clones of embryonic stem (ES) cells. The DNA was digested with BamHI and hybridized to probes. The 5' probe detected fragments of 8 and 12 kb in the wild-type and mutant alleles, respectively, whereas the 3' probe detected fragments of 10 and 6.5 kb in the wild-type and mutant alleles, respectively. The genotypes of selected ES clones were also confirmed by polymerase chain reaction (PCR) using the three primers mentioned in (A). The PCR products of 0.3 and 0.6 bp were obtained from the wild-type and the mutant alleles, respectively. ES cells were screened once using Southern blotting, and the genotypes were confirmed by PCR. C) Genotyping of mice was performed with PCR using genomic DNA isolated from tail samples. The 0.3- and 0.6-bp bands represent the PCR products obtained from the wild-type and the mutant alleles, respectively. D) Expression of Gprc5a, Gprc5b, and Gprc5c mRNAs in adult mouse lung. Total RNA was isolated from whole lungs excised from Gprc5a wild-type (+/+), heterozygous Gprc5a (+/–), and homozygous Gprc5a (–/–) mice and analyzed by reverse transcription–PCR. The images represent one of two independent PCR analyses that were performed in triplicate.

 
No developmental abnormalities or differences from the wild-type littermates were detected by visual inspection or by histologic examination of formalin-fixed, paraffin-embedded Gprc5a (+/–) and (–/–) mouse embryos at days 11 and 17 pc. The newborn and 6-month-old Gprc5a gene-targeted mice were similar to their homozygous wild-type counterparts in size, weight, and activity. Adult mice of all three genotypes had similar reproductive potential.

Analysis of Gprc5a Gene Promoter Activity in Embryos and Adult Mice

LacZ reporter activity of the Gprc5a promoter was detected by X-gal staining (blue-green color) of intact whole-mount Gprc5a (–/–) embryos or their excised lungs on day 17 pc but not in the corresponding (+/+) embryos or day 13.5 pc (–/–) or (+/+) embryos (Fig. 3, A and B). LacZ activity was located in the epithelial cells lining the airway in the lung (Fig. 3, D). In day 17 pc Gprc5a (–/–) embryos, the intestinal tract was also stained with X-gal (Fig. 3, C and E). In adult Gprc5a (–/–) mouse lungs, X-gal staining was detected predominantly in the epithelial cells lining small-sized bronchioli and in the junctions between bronchioles and alveolar epithelium, with lower yet distinct staining in alveolar cells (Fig. 3, F). In contrast, the intensity of X-gal staining was low in the larger bronchioles of (–/–) mice (Fig. 3, F), and no staining was observed in mesenchymal tissues. X-gal staining in intestinal tissue was diminished in adult (–/–) mice (Fig. 3, G).

View larger version (97K): [in this window] [in a new window] [Download PowerPoint slide]   Fig. 3 Detection of the expression of the reporter gene LacZ driven by the endogenous Gprc5a promoter in mouse embryos and adult mouse tissue by staining with X-gal. A–B) Whole mounts of day 17 postcoitus (pc) (A) and day 13.5 pc (B) homozygous embryos (Gprc5a–/–) and their wild-type (+/+) littermates were incubated with the LacZ substrate X-gal. LacZ expression was detected as a blue-green stain. The lower panels in (A) and (B) show lungs excised from stained embryos. C) An X-gal stained 17 day pc Gprc5a (–/–) embryo sectioned longitudinally shows LacZ expression in the lungs and intestine. D–E) Photomicrographs of sections of the same embryo's lung and intestine counterstained with the nuclear stain fast red showing LacZ activity (expression) in cells lining the airways (D) and intestinal tract (E). F–G) Whole mounts of lung (F) and intestine (G) excised from a 3-month-old Gprc5a (–/–) mouse were incubated in X-gal solution and then sectioned, counterstained with nuclear fast red, and photographed. In panel (F), LBr = large bronchiole; Br = bronchiole; bal = bronchioalveolar junction; Al = alveolus; larger arrows point to sites of X-gal staining in bronchiolar epithelial cells and small arrow heads to staining in alveolar cells. Scale bars = 5 mm in panels A, B, and C and 100 µm in panels D, E, F, and G.

 
Spontaneous Development of Lung Tumors in Gprc5a Gene Knockout Mice

Mice of the three genotypes were killed between 1 and 2 years, and the mean incidence of lung tumors was determined. Mean incidence in Gprc5a (+/+), (+/–), and (–/–) mice was 2% (95% CI = 0% to 6%), 15.1% (95% CI =7.8% to 22.3%), and 63.6% (95% CI = 49.4% to 77.9%), respectively. The differences between the incidence in +/– and +/+ mice, in –/– and +/+ mice, and in –/– and +/– mice were all statistically significant (P = .019, P<.001, and P<.001, respectively; Fig. 4, A). No tumors were found in mice younger than 10 months, and most tumors were detected in mice killed after 18 months. Lungs had tumors of different sizes and multiplicities (Fig. 4, B–G). The tumor in Fig. 4, B, was identified as a papillary adenoma (Fig. 4, H and K). Two large tumors (Fig. 4, C and F) were identified as papillary adenocarcinomas (Fig. 4, I and L, respectively). One tumor was so aggressive that it had replaced most of the lung tissue (Fig. 4, D) and metastasized to multiple lymph nodes (Fig. 4, G); it was identified as an adenosquamous carcinoma (Fig. 4, J and M).

View larger version (53K): [in this window] [in a new window] [Download PowerPoint slide]   Fig. 4 Spontaneous tumor formation in Gprc5a (+/+), (+/–), and (–/–) mice. A) Mice were killed between the ages of 10 and 24 months, and tumors were detected by visual inspection of the lung exterior after necropsy. P values (calculated using a two-sided z test) at the bottom of the panel indicate the statistical significance of difference in tumor incidence in (+/–) and (–/–) mice compared with (+/+) mice and in (–/–) mice compared with (+/–) mice. B–G) Images of tumors in lungs excised from (–/–) mice killed at ages 12 (B, E), 18 (C), 20 (D), or 24 (F) months. Arrows point to one or more primary lung tumors; (G) lymph nodes containing metastases from the primary lung tumor shown in (D). H–M) The excised lungs were fixed in formalin, embedded in paraffin, and sectioned. The sections were stained with hematoxylin and eosin and photographed under the microscope at a low (H) or high (I–M) magnification. Histology of the tumor in panel B (adenoma) is shown in (H and K). Histologies of the tumors shown in panels C, D, F, and G are shown in (I, J, L, and M), respectively (I and L, adenocarcinoma; J and M, adenosquamous carcinomas). Scale bar = 5 mm in panel B, and panels B–G are at the same magnification. Scale bar = 1 mm in panel H. Scale bar = 100 µm in panel I, and all panels from I to M are at the same magnification.

 
Microscopic analysis of histologic sections from formalin-fixed, paraffin-embedded lungs by a veterinary pathologist (C. S. Van Pelt) (Table 1) revealed that the incidence of adenomas in homozygous knockout mice (76% [31/41]) was statistically significantly (P<.001) higher than in heterozygous or wild-type mice (11% [9/80]) and 10% [5/51], respectively). The histologies of the 41 adenomas in (–/–) mice included 16 (39%) papillary, 10 (24%) solid, and 4 (10%) mixed. In contrast, the (+/–) and (+/+) mice had only papillary adenomas. Importantly, 17% (7/41) of the Gprc5a (–/–) mice developed malignant tumors (six papillary adenocarcinomas and one adenosquamous carcinoma). In contrast, none of the (+/–) and (+/+) mice had malignant tumors. These data indicate that loss of the Gprc5a gene increases tumor incidence and enhances the progression of adenomas to adenocarcinomas.

View this table: [in this window] [in a new window]   Table 1 Identification and histologic evaluation of lesions in lungs from Gprc5a wild-type and knockout mice

 
Lymphomas developed at similar frequencies (7.5%–12%) in all mouse genotypes. However, a statistically significantly increased incidence of acidophilic macrophage pneumonia was detected in the (–/–) mice (36.6%) compared with (+/–) (3.7%) and (+/+) (9.8%) mice (Table 1).

Analysis of Differentiation Markers and K-Ras Mutations in Lung Tumors From Gprc5a Knockout Mice

The majority of the tumors from Gprc5a knockout mice expressed alveolar type II (AT2) cell markers (Fig. 5). SP-A was detected in six of seven adenomas and three of six adenocarcinomas, SP-B in eight of eight adenomas and five of six adenocarcinomas, and proSP-C in eight of eight adenomas and five of six adenocarcinomas; however, all samples were negative for the Clara cell marker CCSP. The single adenosquamous carcinoma and its lymph node metastasis were positive for the squamous marker involucrin (Fig. 5, E and F). However, two of nine adenomas and one of six adenocarcinomas also stained positive for involucrin (Fig. 5, E and F, middle and right panels). The adenomas that developed in the Gprc5a (+/+) and Gprc5a (+/–) mice showed similar patterns of expression of AT2 cell markers (data not shown). No Ras mutations at codons 12, 13, or 61 were detected in any of the five adenocarcinomas from five different Gprc5a (–/–) mice tested by PCR and sequencing (data not shown).

View larger version (132K): [in this window] [in a new window] [Download PowerPoint slide]   Fig. 5 Analysis of differentiation markers and Gprc5a in lung tissues by immunohistochemical methods. A–F) Histologic sections of adjacent normal-appearing lung tissues and tissues containing adenoma, adenocarcinoma, or adenosquamous carcinoma from Gprc5a (–/–) mice were subjected to immunohistochemical analysis of type II cell markers: surfactant Protein A (SP-A, A), surfactant Protein B (SP-B, B), prosurfactant Protein C (SP-C, C), Clara cell marker CCSP (D), and the squamous cell differentiation marker involucrin (E, F). G–H) The expression of Gprc5a protein was analyzed by immunohiostochemical methods in sections of lung tissues from adult Gprc5a (+/+) mice (G) or Gprc5a (–/–) mice (H). The arrowheads in panel G point to cells expressing Gprc5a in bronchiole (Br) and alveoli (Al). Scale bars = 100 µm in panels A (normal) and G. All panels in A–F are at the same magnification and panels G and H are at the same magnification. The images shown represent one of three independent experiments, each performed in duplicate.

 
Localization of Gprc5a Protein in Mouse Lung

Most alveolar epithelial cells and some cells lining the bronchioles expressed Gprc5a protein, as revealed by immunohistochemical staining of histologic sections prepared from Gprc5a (+/+) mice (Fig. 5, G). The staining appeared specific in that similar sections of lungs from Gprc5a (–/–) mice were not stained (Fig. 5, H).

GPRC5A mRNA Levels in Human NSCLC Tumors and Paired Normal Lung Tissues

A total of 11 of 18 (61%) pairs of NSCLC and adjacent normal tissue had a lower level of GPRC5A mRNA in the tumors (Fig. 6, A–D), two (11%) had a higher level of GPRC5A mRNA in the tumors (Fig. 6, B), one had similar levels in tumor and normal samples (Fig. 6, B, case 129), and four had no GPRC5A mRNA in either sample (Fig. 6, D). GPRC5A suppression was similar in adenocarcinomas and squamous cell carcinomas. These results indicate that GPRC5A mRNA expression was decreased in the majority of the human NSCLC studied and possibly also in some adjacent normal tissues.

View larger version (46K): [in this window] [in a new window] [Download PowerPoint slide]   Fig. 6 Expression of GPRC5A mRNA in human non–small-cell lung cancer (NSCLC) and normal lung tissues. A–D) Expression of GPRC5A mRNA in paired human NSCLC and normal lung tissues. RNA was extracted from surgical specimens of 18 primary NSCLC (T) and adjacent normal-appearing tissue (N) and subjected to duplex reverse transcription–polymerase chain reaction (RT–PCR) using primers for GPRC5A and -actin combined. For samples in (A) and (B), 30 cycles of PCR were used; however, when no GPRC5A was observed after 30 cycles (groups C and D), 35 cycles were used. E) Analysis of the expression of GPRC5A mRNA in different human lung cancers and normal lung tissues. Standardized expression values were extracted from raw data published by Bhattacharjee et al. (22) and are reported according to the diagnosis (N = normal; ADC = adenocarcinoma; SCC = squamous cell carcinoma; SCLC = small-cell lung cancer; COID = carcinoid). Each circle corresponds to a different sample. Whiskers (long dashes) in each group in the graph represent means, and 95% confidence intervals are represented by short dashes. All P values (two-sided) were calculated using the z test.

 
Comparison of GPRC5A Gene Expression in Different Types of Human Lung Cancer and Normal Lung Tissue Using Microarray Data

A dataset that includes gene expression profiling obtained using human U95A oligonucleotide probe arrays (Affymetrix, Santa Clara, CA) of 186 lung tumors and 17 normal control tissues and clinical data on age and sex of the patient, smoking history, type of resection, postoperative pathologic staging and histopathologic diagnosis, patient survival information, time of last follow-up interval or time of death from the date of resection, and disease status at last follow-up or death was available from the report of Bhattacharjee et al. (22). The expression of GPRC5A mRNA in those samples was statistically significantly lower in all types of lung cancer analyzed than in normal lung tissue. The mean value of GPRC5A mRNA levels in normal lung tissue specimens (n = 17) was 409.4 standardized intensity units (95% CI = 341.8 to 490.2). The corresponding values for lung tumors were as follows: adenocarcinoma (n = 139), 189.2 (95% CI = 163.6 to 218.8), P = .014; squamous cell carcinoma (n = 21), 30.6 (95% CI = 15.7 to 59.7), P<.001; small-cell lung cancer (n = 6), 21.7 (95% CI = 5.2 to 89.7), P<.001; and carcinoid (n = 20), 7.4 (95% CI = 3.5 to 15.8), P<.001. The mean GPRC5A mRNA levels as a percentage of that in normal tissues were as follows: adenocarcinoma, 46.2%; squamous cell carcinoma, 7.5%; small-cell lung cancer, 5.3%; and carcinoid, 1.8% (Fig. 6, E). Further analysis of GPRC5A mRNA expression in the adenocarcinomas, for which clinical and pathologic data were available, found no relationship between GPRC5A expression and sex, smoking status, K-Ras mutation status, tumor stage (stages I–IV were represented), or survival (data not shown). However, expression decreased from normal tissue to well-differentiated to moderately differentiated to poorly differentiated adenocarcinomas (Spearman r = .37, P<.001; linear regression analysis, P<.001 for testing 0 slope, data not shown).

Cellular Localization of GPRC5A-myc Expression and Effects of Exogenous GPRC5A on the Anchorage-Independent Growth of Cancer Cells

The human H1792 and HEK293F cells, which express low levels of GPRC5A mRNA (data not shown), and the mouse cell line MDA1478, which had been derived from a lung tumor from a Gprc5a –/– mouse, were stably transfected with a myc-tagged GPRC5A expression vector. The stable transfectants were found to express the myc-tagged protein, as evidenced by immunoblotting (Fig. 7, A, C, and E). GPRC5A-myc was localized in perinuclear vesicles (probably Golgi) and the plasma membrane in all three cell lines (Fig. 7, B, D, and F). Most of the GPRC5A staining was extranuclear (Fig. 7, B). The lack of fluorescent staining of cells transfected with vector control and incubated with anti-myc tag antibodies (Fig. 7, B, upper left panel) indicates that the anti-myc antibodies did not detect endogenous cellular myc protein.

View larger version (44K): [in this window] [in a new window] [Download PowerPoint slide]   Fig. 7 Effect of expression of exogenous human GPRC5A on anchorage-independent colony formation. A-F) Human embryonic kidney HEK293F (A, B), human non–small-cell lung carcinoma H1792 (C, D), and mouse adenocarcinoma MDA1478 cells (E, F) were transfected with vector control (V) or a vector containing GPRC5A-myc-tag (GM), and stable transfectants were isolated and analyzed by western blotting using anti-myc tag antibodies for the expression of the GPRC5A-myc transgene (A, C, E). Anti–-actin antibodies were used to reprobe the same membranes to control for loading and transfer. In A, n.s. indicates nonspecific bands. Anti-myc tag antibodies were also used to localize myc-tagged GPRC5A by immunofluorescence (B, D, F). In (B), cell nuclei were stained with 4',6-diamidino-2-phenylindole (DAPI) and GPRC5A with anti-myc tag antibody followed by fluorescently labeled secondary antibodies. An overlay of the GPRC5A staining and the nuclear staining is shown in the bottom panels on the left. The scale bars in panels B, D, and F represent 10 µm. G–L) Vector control and GPRC5A-myc tag transfected cells were suspended in agarose:Matrigel (1:1) and analyzed for colony formation over 2 weeks (see "Materials and Methods"). The number of colonies in four x40 microscopic fields was determined, and the data are presented in the bar graphs as the mean (and 95% confidence intervals) number of colonies in one microscopic field. The photomicrographs of colonies at a high and low magnification are shown. The differences between the number of colonies in vector-transfected and GPRC5A-transfected cells were statistically significant (P<.001; two-sided z test) for all the cell lines. The scale bars in the lower and higher magnification panels represent 0.2 and 0.5 mm, respectively.

 
The three cell lines formed colonies in semisolid medium with different efficiencies. The H1792 formed the most colonies, and the HEK293F and MDA1478 cells formed fewer colonies (Fig. 7, H–K). The mean number of colonies formed in the cell line pairs stably transfected with control vector or GPRC5A expression vector were as follows: H1792 control versus H1792/GPRC5A, 528 versus 47.7, difference = 480.3 (95% CI = 427.4 to 533.2), P<.001; HEK293 control versus HEK293/GPRC5A, 29 versus 2.7, difference = 26.3, (95% CI = 21.1 to 31.6), P<.001; MDA1478 control versus MDA1478/GPRC5A, 43 versus 13.7, difference = 29.3 (95% CI = 21.9 to 36.8), P<.001 (Fig. 7, H, J, L and G, I, K). Thus, stable expression of GPRC5A-myc suppressed colony formation in these cell lines by 91%, 91%, and 68%, respectively.

	Discussion

Top Abstract Context and Caveats Materials and Methods Results Discussion Funding References Notes

 
We generated mice with a deletion of mouse RA-inducible Gprc5a, which is expressed in lung airway epithelial cells, and found that they develop normally. However, during the second year of their life, most Gprc5a (–/–) mice developed lung tumors at a much higher incidence than wild-type (+/+) mice. The data also indicate that loss of the Gprc5a gene led to an enhanced progression of adenomas to adenocarcinomas. These results demonstrate that Gprc5a acts as a tumor suppressor in the mouse lung. To our knowledge, this is the first mouse model in which knockout of a single gene that is expressed primarily in the lung leads to lung cancer development. Furthermore, the level of human GPRC5A mRNA was lower in the majority of human lung tumors than in adjacent normal lung tissue, and GPRC5A overexpression suppressed lung cancer cell colony formation in semisolid medium, indicating the mouse model's relevance to human lung cancer.

Nonetheless, this study has several potential limitations. First, we do not know what genetic or epigenetic changes or other "tumor promoting" process(es) had occurred during the 12–24 months between birth and tumor appearance. Second, the knockout mice were not exposed to any carcinogen and were maintained in a pathogen-free environment, whereas human lung cancer is caused by exposure to tobacco smoke constituents and other carcinogenic and proinflammatory agents. It is possible that infections leading to inflammation or exposure to tobacco carcinogens would have enhanced carcinogenesis in this mouse model. Third, the mouse Gprc5a gene is deleted in our mouse model; however, deletions of chromosome 12p13-12.3 are not that frequent in human NSCLC tumors, raising the possibility that the expression of the human gene GPRC5A may be silenced by epigenetic mechanisms in at least a subset of human NSCLC tumors.

Although Gprc5a appears to be a new tumor suppressor in the mouse lung, it is dispensable for development and survival of the embryo and for development and growth of newborn and adult mice. This phenotype is similar to that of the tumor suppressor p53 knockout mouse, which develops normally but acquires a variety of spontaneous malignancies within 6 months of age (28).

In 2004, we presented preliminary data on the development of lung tumors in the Gprc5a (–/–) mouse (29). While we were repeating the experiments with a larger number of knockout mice, Xu et al. (30) described the generation of a similar knockout mouse, which also showed no apparent changes in lung cell differentiation and structure. By monitoring our Gprc5a knockout mice for up to 24 months, we were able to find that many of them developed spontaneous adenomas and adenocarcinomas with a much higher incidence than the Gprc5a (+/–) or (+/+) mice, which developed only adenomas. It is noteworthy that mouse pulmonary adenomas usually give rise to carcinomas and are a part of an adenoma–carcinoma carcinogenesis continuum (19,31).

The requirement of 10–24 months for development of tumors in the Gprc5a (–/–) mice is similar to that in other mouse lung carcinogenesis models described below and is relevant to human lung carcinogenesis, which may take more than 20 years. A plausible explanation for the slow development is that, in addition to the loss of Gprc5a, the development of tumors requires somatic genetic or epigenetic changes that increase with age, as indicated by the identification of an average of more than 10 genetic lesions in different human cancers (32).

Gprc5a mRNA expression and the LacZ activity indicative of Gprc5a promoter activity were detected in epithelial cells lining the bronchioles and at a lower level in alveolar cells in Gprc5a (–/–) mouse lungs. However, Gprc5a protein staining was more intense in alveolar cells than in bronchiolar cells of Gprc5a (+/+) mice. It is possible that the translation rate of Gprc5a mRNA or Gprc5a protein stability is different in bronchiolar and alveolar cells. This protein localization may explain why the majority of the tumors in our model appear to have been derived from cells expressing the AT2 differentiation markers, consistent with previous studies that have implicated AT2 cells as the cell of origin of rodent and human lung adenocarcinomas (33–35).

In addition to the frequently used A/J mouse strain, which develops spontaneous K-Ras–driven lung tumors at advanced age (35,36), additional mouse models for lung cancer have been developed by the selective expression of oncogenes [e.g., K-Ras (37), EGFR mutants (38), c-myc (39–41), Achete-Scute homolog-1 with SV40 T antigen (40,42), HPV E6/E7 (41), Raf-1 (40,41), or IgEGF (41)] or ablation or suppressed expression of tumor suppressor genes [e.g., Rb (39,41), p53 (39,41), Mad2 (39), E2F1 (39), antisense RAR2 (41), or Dutt1/Robo1 (43)]. The lung lesions in these models include hyperplasias, adenomas, adenocarcinomas, and neuroendocrine tumors, which develop in mice at ages between 2 and 20 months. The induced expression of oncogenes such as K-Ras and some EGFR mutants have led to useful models of adenocarcinomas and bronchioalveolar cancers, which are relevant for subsets of about 30% and 10% of human NSCLC cancers, respectively (34,38). The lack of K-Ras mutations in the tumors that developed in our Gprc5a knockout model may be important because the carcinogenesis pathway observed in this model may be relevant for the more than 65% of human NSCLCs that do not have K-Ras mutations. The lack of K-Ras mutations in the tumors of Gpcr5a (–/–) mice may be due to the effect of the partial C57BL/6 genetic background in the C57BL/6 X 129sv mice because only one of 22 lung tumors from C57BL/6 mice that were treated with the lung-specific tobacco carcinogen 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) and followed for 27 months contained an activated K-Ras gene (33). Alternatively, the lack of K-Ras mutations in our study may be a function of low specimen numbers.

Germline deletion of tumor suppressor genes involved in lung tumorigenesis (e.g., Trp53, p19^ARF, p16^INK4a) has often resulted in embryonal or perinatal lethality, and even mice that lived to adulthood developed tumors in many organs, with only a small percentage developing lung tumors (28,42). The targeted disruption of both alleles of the 3p12 gene Dutt1/Robo1 leads to frequent perinatal lethality, and survivors develop bronchial hyperplasia but no tumors (43). However, the heterozygous mice, which show no abnormalities, exhibit increased predisposition to develop lymphomas (40%) and lung tumors (26%) after 20 months (44). In the CCSP (CC10) knockout model, aging mice often develop multiorgan tumors (45). Our Gprc5a knockout mouse is the only model, to our knowledge, in which deletion of a single gene has been found to lead to marked spontaneous development of tumors in the lungs.

Animal models are most relevant when they recapitulate the corresponding human disease. Indeed, loss of heterozygosity of chromosome 12p13 has been detected in 29% of NSCLC, suggesting that this region is a hot spot for NSCLC-associated tumor suppressor gene(s) (46,47). It is tempting to suggest that GPRC5A is the candidate tumor suppressor at 12p13. Loss of heterozygosity occurred in less than 30% of the NSCLC in those studies, and it could only account for one half of the suppression of its expression because we found that GPRC5A mRNA levels were lower in 60% of the human NSCLC tumors relative to adjacent normal lung tissues. Epigenetic silencing mechanisms may account for at least a part of the suppressed expression, as was found for the candidate 3p12 tumor suppressor Dutt1/Robo1 (43) and the 3p21.3 tumor suppressor gene BLU in human cancers (48). Indeed, the induction of GPRC5A expression in NSCLC cell lines by RA (6) supports the idea of epigenetic silencing of GPRC5A. Furthermore, a recent microarray analysis (49) of mRNA from cells treated with 5'-aza-2-deoxycytidine and the histone deacetylase inhibitor suberoylanilide hydroxamic acid identified GPRC5A (named RAI3 in that report) as one of several epigenetically silenced potential tumor suppressors in human NSCLC. Furthermore, GPRC5A mRNA was decreased in 48% of 25 matched pairs of human NSCLC tumors and normal lung tissues (49). These findings provide independent support for some of our experimental data and for the conclusion that GPRC5A is likely to function as a new human lung tumor suppressor. The decrease in GPRC5A gene expression in a variety of lung cancers compared with normal lung tissues also supports the conclusion that the Gprc5a knockout mouse is a model for human lung carcinogenesis and that GPRC5A may function as a tumor suppressor in human lungs.

Numerous GPCRs and their ligands modulate normal and malignant cell growth and transformation (50). Interestingly, the activation of some GPCRs (e.g., hOT7T175 or GPR54 and sphingosine 1-phosphate receptor) has been reported to exert tumor suppressor activity (51,52). Our finding that transfection of a GPRC5A expression vector inhibited colony-forming ability of HEK293F cells, NSCLC H1792, and mouse lung adenocarcinoma MDA1478 cells suggests an effect on the transformed phenotype that results in the loss of anchorage independence (53) or resistance to anoikis (54). Indirect support for our suggestion that GPRC5A may function as a tumor suppressor comes from a recent report that the transcription repressor ZNF217, which is amplified in many tumors and considered to be an oncogene (55), represses GPRC5A expression in breast and embryonal carcinoma cells (56). Furthermore, GPRC5A binds to the seven-transmembrane frizzled receptors and may activate noncanonical Wingless (Wnt) signaling, which controls cellular migration, differentiation, and proliferation (57). Noncanonical Wnt signaling can antagonize canonical Wnt signaling by enhancing -catenin degradation and suppress tumorigenicity (58,59). Therefore, it is possible that activation of noncanonical Wnt signaling by Gprc5a might provide a mechanism of tumor suppression.

Because the ligand of GPRC5A is unknown, a possible explanation for the activity of the transfected Gprc5a without deliberately adding the ligand is as follows: 1) the cells produce the putative ligand, 2) the ligand is present in the growth medium or serum, 3) GPRC5A overexpression results in a constitutively active receptor, or 4) the GPCR5A protein can achieve an active conformation spontaneously (60). Our findings differ from the recent report by Wu et al. (61) that ectopic expression of GPCR5A in HEK293 cells promoted anchorage-independent growth. The reason for this difference is not clear.

In summary, we found that Gprc5a functions as a tumor suppressor in the mouse lung and obtained data that support the conclusion that the human GPRC5A may act as a tumor suppressor in human lung carcinogenesis as well. The Gprc5a knockout mouse seems to be a unique new model that is expected to provide novel information on the mechanisms of K-Ras mutation-independent lung carcinogenesis and to serve as a model for the assessment of the activity and mechanisms of chemopreventive and therapeutic agents.

	Funding

Top Abstract Context and Caveats Materials and Methods Results Discussion Funding References Notes

 
Samuel Waxman Cancer Research Foundation (R. L.); the Irving and Nadine Mansfield and Robert David Levitt Cancer Research Chair (R. L.); National Institutes of Health Cancer Center Support Grant P30 CA16672 (University of Texas M. D. Anderson Cancer Center) (Transgenic Animal Facility, DNA Sequencing, Veterinary Medicine).

	NOTES

Top Abstract Context and Caveats Materials and Methods Results Discussion Funding References Notes

 
Present address: Internal Medicine, Brookdale University Hospital and Medical Center, One Brookdale Plaza, Brooklyn, NY 11212 (Q. Tao).

Present address: Louisiana State University Health Sciences Center, 1501 Kings Highway, Shreveport, LA 71130 (J. L. Clifford).

Present address: Department of Biopathology, Gustave-Roussy Institute, 39 rue Camille Desmoulins, 94805 Villejuif, France (L. Lacroix).

The authors had full responsibility for the design and conduct of the study, analyses and interpretation of the data, decision to submit the manuscript for publication, and the writing of the manuscript. We thank the Transgenic Mouse Core Facility at M. D. Anderson for the embryonal stem cell culture and microinjection and the Pathology Core of the Department of Thoracic/Head and Neck Medical Oncology at M. D. Anderson for preparing some of the histologic sections.

	REFERENCES

Top Abstract Context and Caveats Materials and Methods Results Discussion Funding References Notes

 

(1) Love JM, Gudas LJ. Vitamin A, differentiation and cancer. Curr Opin Cell Biol (1994) 6:825–31.[CrossRef][Web of Science][Medline]

(2) Sun SY, Lotan R. Retinoids and their receptors in cancer development and chemoprevention. Crit Rev Oncol Hematol (2002) 41:41–55.[Web of Science][Medline]

(3) Dragnev KH, Petty WJ, Ma Y, Rigas JR, Dmitrovsky E. Nonclassical retinoids and lung carcinogenesis. Clin Lung Cancer (2005) 6:237–44.[Medline]

(4) Bastien J, Rochette-Egly C. Nuclear retinoid receptors and the transcription of retinoid-target genes. Gene (2004) 328:1–16.[CrossRef][Web of Science][Medline]

(5) Mark M, Chambon P. Functions of RARs and RXRs in vivo: genetic dissection of the retinoid signaling pathway. Pure Appl Chem (2003) 75:1709–32.[CrossRef][Web of Science]

(6) Cheng Y, Lotan R. Molecular cloning and characterization of a novel retinoic acid-inducible gene that encodes a putative G protein-coupled receptor. J Biol Chem (1998) 273:35008–15.[Abstract/Free Full Text]

(7) Recasens M, Guiramand J, Aimar R, Abdulkarim A, Barbanel G. Metabotropic glutamate receptors as drug targets. Curr Drug Targets (2007) 8:651–81.[CrossRef][Web of Science][Medline]

(8) Tao Q, Cheng Y, Clifford J, Lotan R. Characterization of the murine orphan G-protein-coupled receptor gene Rai3 and its regulation by retinoic acid. Genomics (2004) 83:270–80.[CrossRef][Web of Science][Medline]

(9) Robbins MJ, Michalovich D, Hill J, Calver AR, Medhurst AD, Gloger I, et al. Molecular cloning and characterization of two novel retinoic acid-inducible orphan G-protein-coupled receptors (GPRC5B and GPRC5C). Genomics (2000) 67:8–18.[CrossRef][Web of Science][Medline]

(10) Brauner-Osborne H, Jensen A, Sheppard PO, Brodin B, Krogsgaard-Larsen P, O'Hara P. Cloning and characterization of a human orphan family C G-protein coupled receptor GPRC5D. Biochim Biophys Acta (2001) 1518:237–48.[Medline]

(11) Inoue S, Nambu T, Shimomura T. The RAIG family member, GPRC5D, is associated with hard-keratinized structures. J Invest Dermatol (2004) 122:565–73.[CrossRef][Web of Science][Medline]

(12) Cheng Y, Lotan D, Lotan R. Molecular cloning of mRAIG1, a mouse homologous cDNA for human RAIG1, and its expression during ATRA-induced differentiation of P19 embryonic carcinoma cells. Proc Am Assoc Cancer Res (1999) 40:308.

(13) Tao Q, Lotan D, Lotan R. Molecular cloning of two novel murine retinoic acid-inducible orphan G-protein-coupled receptors (mGPRC5B and mGPRC5C), their expression in adult mouse tissues and embryos, and their induction by retinoic acid during embryonal carcinoma cell differentiation. Proc Am Assoc Cancer Res (2005) 46:987.

(14) Cheah SS, Behringer RR. Contemporary gene targeting strategies for the novice. Mol Biotechnol (2001) 19:297–304.[CrossRef][Web of Science][Medline]

(15) Wurst W, Joyner AL. Production of targeted embryonic stem cell clones. In: Gene targeting, a practical approach—Joyner AL, ed. (1993) Oxford (U.K): Oxford University Press. 33–61.

(16) Xu XC, Clifford JL, Hong WK, Lotan R. Detection of nuclear retinoic acid receptor mRNAs in histological tissue sections using non-radioactive in situ hybridization histochemistry. Diagn Mol Pathol (1994) 3:122–31.[Web of Science][Medline]

(17) Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JD, Simith JA, et al, eds. Current protocols in molecular biology (2006) New York (NY): John Wiley & Sons Inc.

(18) Boorman GA, Herbert RA. Alveolar/bronchiolar hyperplasia, adenoma, and carcinoma, lung, rat. In: Respiratory system. Ilsi monographs on pathology of laboratory animals—Jones TC, Dungworth DL, Mohr U, eds. (1996) Berlin (Germany): Springer. 174–83.

(19) Nikitin AY, Alcaraz A, Anver MR, Bronson RT, Cardiff RD, Dixon D, et al. Classification of proliferative pulmonary lesions of the mouse: recommendations of the mouse models of human cancers consortium. Cancer Res (2004) 64:2307–16.[Abstract/Free Full Text]

(20) Chakravarti N, Mathur M, Bahadur S, Shukla NK, Rochette-Egly C, Ralhan R. Expression of RAR alpha and RAR beta in human oral potentially malignant and neoplastic lesions. Int J Cancer (2001) 91:27–31.[CrossRef][Web of Science][Medline]

(21) Jang SJ, Soria JC, Wang L, Hassan KA, Morice RC, Walsh GL, et al. Activation of melanoma tumor antigens occurs early in lung carcinogenesis. Cancer Res (2001) 61:7959–63.[Abstract/Free Full Text]

(22) Bhattacharjee A, Richards WG, Staunton J, Li C, Monti S, Vasa P, et al. Classification of human lung carcinomas by mRNA expression profiling reveals distinct adenocarcinoma subclasses. Proc Natl Acad Sci U S A (2001) 98:13790–5. Supporting information available at http://www.pnas.org. [Last accessed: October 12, 2007.].[Abstract/Free Full Text]

(23) Graham FL, Smiley J, Russell WC, Nairn R. Characteristics of a human cell line transformed by DNA from human adenovirus type 5. J Gen Virol (1977) 36:59–74.[Abstract/Free Full Text]

(24) Xu L, Schantz SP, Edelstein D, Sacks PG. A simplified method for the routine culture of normal oral epithelial (NOE) cells from upper aerodigestive tract mucosa. Methods Cell Sci (1996) 18:31–9.[CrossRef]

(25) Smyth GK. Linear models and empirical Bayes methods for assessing differential expression in microarray experiments. Stat Appl Genet Mol Biol (2004) 3. Article 3. Available at http://www.bepress.com/sagmb/vol3/iss1/art3. [Last accessed: October 12, 2007.].

(26) The R Project for Statistical Computing. Available at: http://www.r-project.org/. [Last accessed: October 12, 2007.].

(27) Benjamini Y, Hochberg Y. Controlling the false discovery rate: a practical and powerful approach to multiple testing. J R Stat Soc Ser B (1995) 57:289–300.

(28) Donehower LA, Harvey M, Slagle BL, McArthur MJ, Montgomery CA, Butel JS, et al. Mice deficient for p53 are developmentally normal but susceptible to spontaneous tumours. Nature (1992) 356:215–21.[CrossRef][Medline]

(29) Tao Q, Lotan R. Spontaneous development of lung cancers in mice with deleted retinoic acid-inducible orphan G-protein coupled receptor gene RAI3. Proc Am Assoc Cancer Res (2004) 45:876.

(30) Xu J, Tian J, Shapiro SD. Normal lung development in RAIG1-deficient mice despite unique lung epithelium-specific expression. Am J Respir Cell Mol Biol (2005) 32:381–7.[Abstract/Free Full Text]

(31) Belinsky SA, Devereux TR, Foley JF, Maronpot RR, Anderson MW. Role of the alveolar type II cell in the development and progression of pulmonary tumors induced by 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone in the A/J mouse. Cancer Res (1992) 52:3164–73.[Abstract/Free Full Text]

(32) Sjoblom T, Jones S, Wood LD, Parsons DW, Lin J, Barber T, et al. The consensus coding sequences of human breast and colorectal cancers. Science (2006) 314:268–74.[Abstract/Free Full Text]

(33) Devereux TR, Belinsky SA, Maronpot RR, White CM, Hegi ME, Patel AC, et al. Comparison of pulmonary O⁶-methylguanine DNA adduct levels and Ki-ras activation in lung tumors from resistant and susceptible mouse strains. Mol Carcinog (1993) 8:177–85.[Web of Science][Medline]

(34) Jackson EL, Willis N, Mercer K, Bronson RT, Crowley D, Montoya R, et al. Analysis of lung tumor initiation and progression using conditional expression of oncogenic K-ras. Genes Dev (2001) 15:3243–8.[Abstract/Free Full Text]

(35) Malkinson AM. The genetic basis of susceptibility to lung tumors in mice. Toxicology (1989) 54:241–71.[CrossRef][Web of Science][Medline]

(36) You M, Candrian U, Maronpot RR, Stoner GD, Anderson MW. Activation of the Ki-ras protooncogene in spontaneously occurring and chemically induced lung tumors of the strain A mouse. Proc Natl Acad Sci U S A (1989) 86:3070–4.[Abstract/Free Full Text]

(37) Kim CF, Jackson EL, Kirsch DG, Grimm J, Shaw AT, Lane K, et al. Mouse models of human non-small-cell lung cancer: raising the bar. Cold Spring Harb Symp Quant Biol (2005) 70:241–50.[CrossRef][Medline]

(38) Ji H, Li D, Chen L, Shimamura T, Kobayashi S, McNamara K, et al. The impact of human EGFR kinase domain mutations on lung tumorigenesis and in vivo sensitivity to EGFR-targeted therapies. Cancer Cell (2006) 9:485–95.[CrossRef][Web of Science][Medline]

(39) Herzig M, Christofori G. Recent advances in cancer research: mouse models of tumorigenesis. Biochim Biophys Acta (2002) 1602:97–113.[Medline]

(40) Kwak I, Tsai SY, DeMayo FJ. Genetically engineered mouse models for lung cancer. Annu Rev Physiol (2004) 66:647–63.[CrossRef][Web of Science]

(41) Meuwissen R, Berns A. Mouse models for human lung cancer. Genes Dev (2005) 19:643–64.[Abstract/Free Full Text]

(42) Whitsett JA, Glasser SW, Tichelaar JW, Perl AK, Clark JC, Wert SE. Transgenic models for study of lung morphogenesis and repair Parker B. Francis lecture. Chest (2001) 120:275–30.[CrossRef][Web of Science][Medline]

(43) Xian J, Clark KJ, Fordham R, Pannell R, Rabbitts TH, Rabbitts PH. Inadequate lung development and bronchial hyperplasia in mice with a targeted deletion in the Dutt1/Robo1 gene. Proc Natl Acad Sci U S A (2001) 98:15062–6.[Abstract/Free Full Text]

(44) Xian J, Aitchison A, Bobrow L, Corbett G, Pannell R, Rabbitts T, et al. Targeted disruption of the 3p12 gene, Dutt1/Robo1, predisposes mice to lung adenocarcinomas and lymphomas with methylation of the gene promoter. Cancer Res (2004) 64:6432–7.[Abstract/Free Full Text]

(45) Yang Y, Zhang Z, Mukherjee AB, Linnoila RI. Increased susceptibility of mice lacking Clara cell 10-kDa protein to lung tumorigenesis by 4 (methylnitrosamino)-1-(3-pyridyl)-1-butanone, a potent carcinogen in cigarette smoke. J Biol Chem (2004) 279:29336–40.[Abstract/Free Full Text]

(46) Takeuchi S, Mori N, Koike M, Slater J, Park S, Miller CW, et al. Frequent loss of heterozygosity in region of the KIP1 locus in non-small cell lung cancer: evidence for a new tumor suppressor gene on the short arm of chromosome 12. Cancer Res (1996) 56:738–40.[Abstract/Free Full Text]

(47) Grepmeier U, Dietmaier W, Merk J, Wild PJ, Obermann EC, Pfeifer M, et al. Deletions at chromosome 2q and 12p are early and frequent molecular alterations in bronchial epithelium and NSCLC of long-term smokers. Int J Oncol (2005) 27:481–8.[Web of Science][Medline]

(48) Agathanggelou A, Dallol A, Zochbauer-Muller S, Morrissey C, Honorio S, Hesson L, et al. Epigenetic inactivation of the candidate 3p21.3 suppressor gene BLU in human cancers. Oncogene (2003) 22:1580–8.[CrossRef][Web of Science][Medline]

(49) Gery S, Komatsu N, Kawamata N, Miller CW, Desmond J, Virk RK, et al. Epigenetic silencing of the candidate tumor suppressor gene Per1 in non–small cell lung cancer. Clin Cancer Res (2007) 13:1399–404.[Abstract/Free Full Text]

(50) Dorsam RT, Gutkind JS. G-protein-coupled receptors and cancer. Nat Rev Cancer (2007) 7:79–94.[CrossRef][Web of Science][Medline]

(51) Ohtaki T, Shintani Y, Honda S, Matsumoto H, Hori A, Kanehashi K, et al. Metastasis suppressor gene KiSS-1 encodes peptide ligand of a G-protein-coupled receptor. Nature (2001) 411:613–7.[CrossRef][Medline]

(52) Sanchez T, Thangada S, Wu MT, Kontos CD, Wu D, Wu H, et al. PTEN as an effector in the signaling of antimigratory G protein-coupled receptor. Proc Natl Acad Sci U S A (2005) 102:4312–7.[Abstract/Free Full Text]

(53) Freedman VH, Shin SI. Cellular tumorigenicity in nude mice: correlation with cell growth in semi-solid medium. Cell (1974) 3:355–9.[CrossRef][Web of Science][Medline]

(54) Reddig PJ, Juliano RL. Clinging to life: cell to matrix adhesion and cell survival. Cancer Metastasis Rev (2005) 24:425–39.[CrossRef][Web of Science][Medline]

(55) Quinlan KG, Verger A, Yaswen P, Crossley M. Amplification of zinc finger gene 217 (ZNF217) and cancer: when good fingers go bad. Biochim Biophys Acta (2007) 1775:333–40.[Medline]

(56) Krig SR, Jin VX, Bieda MC, O'geen H, Yaswen P, Green R, et al. Identification of genes directly regulated by the oncogene ZNF217 using ChIP-chip assays. J Biol Chem (2007) 282:9703–12.[Abstract/Free Full Text]

(57) Harada Y, Yokota C, Habas R, Slusarski DC, He X. Retinoic acid-inducible G protein-coupled receptors bind to frizzled receptors and may activate non-canonical Wnt signaling. Biochem Biophys Res Commun (2007) 358:968–75.[CrossRef][Web of Science][Medline]

(58) Olson DJ, Gibo DM. Antisense wnt-5a mimics wnt-1-mediated C57MG mammary epithelial cell transformation. Exp Cell Res (1998) 241:134–41.[CrossRef][Web of Science][Medline]

(59) Topol L, Jiang X, Choi H, Garrett-Beal L, Carolan P, Yang Y. Wnt-5a inhibits the canonical Wnt pathway by promoting GSK-3 independent -catenin degradation. J Cell Biol (2003) 162:899–908.[Abstract/Free Full Text]

(60) Bond RA, Ijzerman AP. Recent developments in constitutive receptor activity and inverse agonism, and their potential for GPCR drug discovery. Trends Pharmacol Sci (2006) 27:92–6.[CrossRef][Medline]

(61) Wu Q, Ding W, Mirza A, Van Arsdale T, Wei I, Bishop WR, et al. Integrative genomics revealed RAI3 is a cell growth-promoting gene and a novel P53 transcriptional target. J Biol Chem (2005) 280:12935–43.[Abstract/Free Full Text]

Manuscript received February 12, 2007; revised September 5, 2007; accepted October 2, 2007.

CiteULike    Connotea    Del.icio.us    What's this?

Editorial about this Article

A New Tumor Suppressor Gene, Selective for Lung Cancer

Michael B. Sporn
J Natl Cancer Inst 2007 99: 1654-1655. [Extract] [Full Text] [PDF]

Related Article in JNCI

IN THIS ISSUE
J Natl Cancer Inst 2007 99: 1653. [Extract] [Full Text] [PDF]

This article has been cited by other articles:

				X. Ye and R. Lotan Potential misinterpretation of data on differential gene expression in normal and malignant cells in vitro Brief Funct Genomic Proteomic, July 1, 2008; 7(4): 322 - 326. [Abstract] [Full Text] [PDF]

				M. B. Sporn A New Tumor Suppressor Gene, Selective for Lung Cancer J Natl Cancer Inst, November 21, 2007; 99(22): 1654 - 1655. [Full Text] [PDF]

This Article Abstract FREE Full Text (PDF) All Versions of this Article: 99/22/1668    most recent djm208v1 Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Add to My Personal Archive Download to citation manager Request Permissions Google Scholar Articles by Tao, Q. Articles by Lotan, R. Search for Related Content PubMed PubMed Citation Articles by Tao, Q. Articles by Lotan, R. Related Collections Editorial about this Article Related Article in JNCI Social Bookmarking          What's this?

Online ISSN 1460-2105 - Print ISSN 0027-8874

Copyright © 2009 Oxford University Press

Oxford Journals Oxford University Press

• Site Map
• Privacy Policy
• Frequently Asked Questions

Other Oxford University Press sites: Oxford University Press Oxford Journals China Oxford Journals Japan American National Biography Booksellers' Information Service Children's Fiction and Poetry Children's Reference Corporate & Special Sales Dictionaries Dictionary of National Biography Digital Reference English Language Teaching Higher Education Textbooks Humanities International Education Unit Law Medicine Music Online Products Oxford English Dictionary Reference Rights and Permissions Science School Books Social Sciences Very Short Introductions World's Classics