© The Author 2006. Published by Oxford University Press.
ARTICLE |
A New Tumor Suppressor DnaJ-like Heat Shock Protein, HLJ1, and Survival of Patients With Non–Small-Cell Lung Carcinoma
Affiliations of authors: Department of Internal Medicine (MFT, CLC, YPY, FYS, PCY), Department of Pathology (CWL), Department of Medical Research (WKC), National Taiwan University Hospital, Taipei, Taiwan; NTU Center for Genomic Medicine, National Taiwan University, Taipei, Taiwan (MFT, CCW, HYC, CLC, YPY, CYW, FYS, HPL, WJC, JJWC, PCY); Department of Biotechnology, Chia-Nan University of Pharmacy and Science, Tainan, Taiwan (MFT); Division of Chest Medicine, Department of Internal Medicine (GCC), Division of Thoracic Surgery, Department of Surgery (CYC), Taichung Veterans General Hospital, Taichung, Taiwan; School of Medicine, China Medical University, Taichung, Taiwan (GCC); Graduate Institute of Epidemiology, National Taiwan University, Taipei, Taiwan (HYC, WJC); Department of Computer Science (CCL), Institutes of Biomedical Sciences and Molecular Biology (FYS, CCL, JJWC), National Chung-Hsing University, Taichung, Taiwan; Institute of Biomedical Sciences, Academia Sinica, Taipei, Taiwan (YSJ, SCL, PCY)
Correspondence to: Jeremy J. W. Chen, PhD, Institutes of Biomedical Sciences and Molecular Biology, National Chung-Hsing University, Taichung, Taiwan (e-mail: jwchen{at}dragon.nchu.edu.tw) and Pan-Chyr Yang, MD, PhD, Department of Internal Medicine, National Taiwan University Hospital, No. 7 Chung-Shan South Road, Taipei 100, Taiwan (e-mail: pcyang{at}ha.mc.ntu.edu.tw).
 |
ABSTRACT |
|---|
 TopNotes Abstract IntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Background: We previously identified DnaJ-like heat shock protein (HLJ1) as a gene associated with tumor invasion. Here, we investigated the clinical significance of HLJ1 expression in non–small-cell lung cancer (NSCLC) patients and its role in cancer progression. Methods: We induced HLJ1 overexpression or knockdown in human lung adenocarcinoma CL1–5 cells and analyzed cell proliferation, anchorage-independent growth, in vivo tumorigenesis, cell motility, invasion, and cell cycle progression. Expression of genes that act downstream of HLJ1 was examined by DNA microarray analysis, pathway analysis, and western blotting. We measured HLJ1 expression in tumors and adjacent normal tissues of 71 NSCLC patients by quantitative reverse transcription–polymerase chain reaction. Associations between HLJ1 expression and disease-free and overall survival were determined using the log-rank test and multivariable Cox proportional hazards regression analysis. Validation was performed in an independent cohort of 56 NSCLC patients. Loss of heterozygosity (LOH) mapping of the HLJ1 locus was analyzed in 48 paired microdissected NSCLC tumors. All statistical tests were two-sided. Results: HLJ1 expression inhibited lung cancer cell proliferation, anchorage-independent growth, tumorigenesis, cell motility, and invasion, and slowed cell cycle progression through a novel STAT1/P21WAF1 pathway that is independent of P53 and interferon. HLJ1 expression was lower in tumors than in adjacent normal tissue in 55 of 71 patients studied. NSCLC patients with high HLJI expressing tumors had reduced cancer recurrence (hazard ratio [HR] = 0.47; 95% confidence interval [CI] = 0.23 to 0.93; P = .03) and longer overall survival (HR = 0.38; 95% CI = 0.16 to 0.89; P = .03) than those with low-expressing tumors. Validation in the independent patient cohort confirmed the association between HLJ1 expression and patient outcome. LOH mapping revealed high frequencies (66.7% and 70.8%) of allelic loss and microsatellite instability (87.5% and 95.2%) of the HLJ1 locus at chromosome 1p31.1. Conclusions: HLJ1 is a novel tumor suppressor in NSCLC, and high HLJ1 expression is associated with reduced cancer recurrence and prolonged survival of NSCLC patients.
|
INTRODUCTION |
|---|
|
TopNotesAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Lung cancer is the most common cause of cancer death and accounts for 17% of the total deaths from cancer. The overall 5-year survival rate for these patients is less than 15% (1,2). Non–small-cell lung carcinoma (NSCLC) is the predominant type of lung cancer (3). Approximately 30% of patients with NSCLC are diagnosed at an early stage of the disease and receive curative surgery. However, disease will recur within 5 years in approximately 40% of these patients (3–5). The current clinical staging systems for lung cancer may have reached their limits in providing critical information that may influence patient management strategies. It is therefore important to identify patients who are at high risk of recurrence or of treatment failure after surgical resection. Identification of the specific genes involved and understanding the molecular pathogenesis in these high-risk patients are urgently needed.
Gene expression profiles have been used to identify possible associations with lung cancer behavior or clinical outcome to better predict patient prognosis (6–10). In a previous study (9), we screened lung cancer cell lines with various invasive abilities using microarray analysis of 9600 genes and identified a panel of 589 (6.1%) genes whose expression was associated with invasion and metastasis. We used information from functional databases and hierarchical clustering analyses to categorize many of these genes by function. We then chose 30 candidate genes of unknown function for further characterization, investigated their mechanisms of action, and verified their functions in cancer patients (10,11). Here, we focused on one of these genes, the HLJ1 gene (DnaJ-like heat shock protein, also known as DNAJB4), whose expression was inversely associated with invasive ability in our previous analysis (9). HLJ1 was recently cloned and classified as a member of the heat shock protein 40 family (Hsp40/DnaJ) (12).
Heat shock proteins are involved in the essential defense mechanism for cellular viability, and their activity can be markedly induced by environmental or pathogenic stresses (13,14). Under normal conditions, heat shock proteins perform essential functions, such as modulating protein activity by changing protein conformation, serving as molecular chaperones, promoting multiprotein complex assembly and disassembly, and ensuring proper protein folding (15–17). Heat shock proteins also have roles in immunologic processes, cell cycle regulation, transcriptional activation, and signal transduction (14,18–20).
Recently, DnaJ-like proteins have been implicated in tumor suppression (21). The loss of function of hTid-1, a human DnaJ protein that is the homologue of the Drosophila tumor suppressor Tid56 protein, could lead to the loss of differentiation capacity of neoplastic cells (21–23). However, the biologic properties of HLJ1 are poorly understood. In particular, whether HLJ1 is a tumor suppressor gene is still unknown. The objective of this study was to investigate the mechanism of action of HLJ1 and its association with survival of NSCLC patients.
|
MATERIALS AND METHODS |
|---|
|
TopNotesAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Cell Culture
The human lung adenocarcinoma cell lines, CL1-0, CL1-1, CL1-5, and CL1-5-F4, in ascending order of invasive competence, were established in previous studies (9,24). Cells were cultured in RPMI-1640 medium (Life Technologies Rockville, MD) with 10% fetal bovine serum (FBS; Life Technologies) and each of penicillin and streptomycin (100 mg/mL each) at 37 °C in a humidified atmosphere of 5% CO2. H1299 cells (p53-null human NSCLC cell line) were cultured in Dulbecco's modified Eagle's medium (Life Technologies) supplemented with 10% FBS. To investigate the effects of interferon (IFN) on HLJ1 expression, CL1-5 cells were treated with IFN-
(500 IU/mL; R&D Systems, Minneapolis, MN) and IFN-
(100 ng/mL; R&D Systems) for 18 hours.
Construction of Expression Vector and Stable Transfection
Total RNA was isolated from CL1-0 cells using Trizol reagent (Life Technologies). First-strand cDNA was reverse-transcribed with SuperScript II reverse transcriptase (Life Technologies) and oligo-dT primer. The HLJ1 coding region (GenBank accession number NM_007034) was amplified by polymerase chain reaction (PCR) using the forward primer 5'-CGCGGATCCATGGGGAAAGACTATTATTGC-3', which introduced an BamHI site, and the reverse primer 5'-GCTCTAGAATTCTATGAGGCAGGAAGATG-3', which introduced an XbaI site, under the following conditions: denaturing for 1 minute at 94 °C, annealing for 1 minute at 55 °C, and elongation for 2 minutes at 72 °C for 35 cycles. The amplified product was cloned into pGEM-T Easy vector (pGEM-HLJ1; Promega, Madison, WI). The coding region of HLJ1 cDNA was subcloned into the constitutive mammalian expression vector pcDNA3, which contains the cytomegalovirus enhancer-promoter (Invitrogen, Carlsbad, CA). The cDNA was then fully sequenced to ensure that no mutations were introduced during the PCR amplification. The resulting plasmid construct was named pcDNA3-HLJ1. Subsequently, CL1-5 cells were seeded in 6-cm dishes at 5 x 105 cells/dish and transfected with pcDNA3-HLJ1 and pcDNA3 empty vector using lipofectamine reagent (Invitrogen), according to the manufacturer's protocol. After culturing in medium containing 400 µg/mL of geneticin (G418; Invitrogen) for 2–3 weeks, individual clones were isolated. Clones that expressed the HLJ1 cDNA coding region were maintained in medium containing 200 µg/mL of geneticin and used for further investigation. We also established an HLJ1-inducible expression system by using Tet-Off Gene Expression Systems (Clontech, Palo Alto, CA), according to the manufacturer's protocol. In the Tet-Off system, gene expression is inactivated when tetracycline is added to the culture medium.
Northern Blot Hybridization
mRNA was isolated using an Oligotex mRNA midi kit (Qiagen, Valencia, CA). mRNA (2 µg) of tested cells was subjected to 1% agarose–formaldehyde gel electrophoresis and transferred to Hybond-N+ nylon membranes (Amersham Life Sciences, Arlington Heights, IL) by capillary action. Blots were prehybridized in a solution of 5x SSC (1x SSC is 0.15 M NaCl plus 0.015 M sodium citrate), 5x Denhardt's solution (1x Denhardt's solution = 0.02% polyvinylpyrrolidone, 0.02% Ficoll, and 0.02% bovine serum albumin), 50 mM sodium phosphate, pH 6.2, salmon sperm DNA (100 µg/mL), and 50% deionized formamide for 4 hours at 42 °C. Digoxigenin-11-dUTP–labeled DNA probes were synthesized by the random primed labeling system (Dig DNA labeling kit, Roche, Mannheim, Germany). Membranes were then hybridized in prehybridization solution with digoxigenin-labeled probes at 42 °C for 16 hours. Membranes were washed twice, 15 minutes each, in 2x SSC/0.5% sodium dodecyl sulfate (SDS) at room temperature, then twice, for 30 minutes each, in 0.1x SSC/0.1% SDS at 52 °C. Hybridized DNA was detected by using the Dig Nucleic Acid Detection Kit (Roche), and signal was captured using the Fujifilm LAS 3000 system (Fujifilm, Tokyo, Japan). The relative amount of HLJ1 RNA in each lane was determined by comparing its signal intensity with that of glyceraldehyde-3-phosphate dehydrogenase (GAPDH), a housekeeping gene used as an internal control for RNA quantity. The experiments were performed three times, each in duplicate.
Polyclonal Antibody Production
The histidine (His)-tagged HLJ1 fusion protein was expressed in bacteria using the QIAexpressionist system (Qiagen, Hilden, Germany). To create the fusion protein, a 1.2-kb fragment of HLJ1 cDNA was excised from pGEM-HLJ1 and subcloned into the pQE30 plasmid, producing an inducible expression vector coding for a His-tagged HLJ1 protein. Subsequently, the recombinant plasmids were transformed into Escherichia coli JM109 cells to produce N-terminal His-tagged HLJ1. Fusion protein expression was induced with 0.2 mg/mL of isopropyl-D-thiogalactopyranoside, and the protein was purified by affinity chromatography with nickel-nitrilotriacetic acid (Ni-NTA) resin (Qiagen), according to the manufacturer's protocol. The purified recombinant protein was dialyzed in phosphate-buffered saline (PBS; 0.1 M sodium phosphate and 0.15 M sodium chloride [pH 7.4]) to remove the denaturant. The recombinant HLJ1 protein was used to produce polyclonal antibodies in mice, and the polyclonal antibody was purified using protein-A Sepharose affinity column (Anawrahta Biotech, Taipei, Taiwan). The specificity of the HLJ1 polyclonal antibody for the purified recombinant HLJ1 protein was tested by enzyme-linked immunosorbent assay, dot blot, and western blot analysis. Mouse experiments were approved by the institutional review board of animal care of the Animal Center, National Taiwan University College of Medicine.
Western Blot
Whole-cell lysates of lung cancer cells CL1-0, CL1-1,CL1-5, CL1-5-F4, and CL1-5 cells with HLJ1 overexpression or HLJ1 knockdown were prepared by incubating cells in RIPA buffer (1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 50mM Tris-HCl, pH 7.5) containing protease inhibitor. Cell lysates were centrifuged at 10 000g for 10 minutes at 4 °C. The supernatant was collected, and the protein concentration was measured using the Bradford method (Bio-Rad, Hemel Hempstead, Herts., UK). Proteins (40 µg) were separated by 10% SDS–polyacrylamide gel electrophoresis and transferred onto nitrocellulose Hybond TM-C Super membranes (Amersham). The membranes were blocked in TBST (0.2 M NaCl, 10 mM Tris, pH 7.4, 0.2% Tween 20)/5% skim milk for 2 hours at room temperature and then incubated with primary antibody in TBST/5% skim milk. The primary antibodies used for western blot analyses were polyclonal mouse anti-HLJ1 (1 : 2000), polyclonal goat anti-STAT1 P91 antibody (0.5 µg/mL; R&D Systems, Wiesbaden, Germany), polyclonal rabbit anti–phospho-STAT1 (Tyr701) antibody (1 : 1000; Chemicon, Temecula, CA), polyclonal rabbit anti–cyclin D1 (1 : 200; Santa Cruz Biotechnology, Santa Cruz, CA), monoclonal mouse anti-P21 (2 µg/mL; R&D Systems), polyclonal rabbit anti-P27 (1 : 200; Santa Cruz Biotechnology), monoclonal mouse anti-P53 (1 : 500; Santa Cruz Biotechnology), and monoclonal mouse anti–-tubulin (1 : 500; Calbiochem, San Diego, CA). The membranes were then washed three times with TBST, followed by incubation with horseradish peroxidase–conjugated secondary antibody (1 : 4000) in TBST/2% skim milk. Bound antibody was detected using the Enhanced Chemiluminescence System (Amersham). Chemiluminescent signals were captured using the Fujifilm LAS 3000 system (Fujifilm). All experiments were performed at least three times in duplicate.
Subcellular Localization of HLJ1
To determine the subcellular localization of HLJ1 in living cells, the HLJ1 fragment was inserted in-frame into pEGFP-C3, a cytomegalovirus promoter–driven enhanced green fluorescent protein (EGFP) expression vector (Clontech). The resulting construct, pEGFP-HLJ1, expresses amino-terminal EGFP–tagged HLJ1. CL1-5 cells (2 x 105 cells/6-cm dish) were transiently transfected with pEGFP-HLJ1 or pEGFP-C3, as a negative control, using lipofectamine reagent (Invitrogen), according to the manufacturer's protocol. The transfected cells were cultured in phenol red–free RPMI-1640 medium supplemented with 10% FBS and antibiotics. The following day, cells were examined and photographed (x400 and x800 magnification) by Zeiss axiphot epifluorescence microscope equipped with an MRC-1000 laser scanning confocal imaging system (Bio-Rad Laboratories, Rockville Center, NY) . Three independent experiments were performed, and at least five fields and 100 cells were examined per experiment.
Small-Interfering RNA Transient Transfection
Desalted siRNA duplexes were synthesized (Qiagen) and were annealed by following the manufacturer's standard protocol. The small-interfering RNA (siRNA) sequences used to knock down the human HLJ1 gene were siHLJ1-A: AACCCGGAATGAGGAGAAGAA, and siHLJ1-D: AAACGCTGATGGA-AGGAGTTA. A scrambled siRNA (siHLJ1-L: GGACAATGAACACGAGGAAGA) was used as the negative control. siRNAs were transfected using the RNAiFect Transfection Reagent (Qiagen) according to the manufacturer's instructions. The CL1-5/HLJ1 (pc-h9) cells that were transiently transfected with siHLJ1-A and siHLJ1-L were defined as pc-h9/si-HLJ1-A and pc-h9/si-HLJ1-L cells, respectively.
In Vitro Cell Invasion Assay
In vitro invasion assays were performed as previously described (25) using transwell chambers (8-µm pore size; Costar, Cambridge, MA) and transwell filters coated with Matrigel (Becton Dickinson, Franklin Lakes, NJ). Cells (105 each of CL1-5, pc-h9, pc-h12, pc-c5, pc-c10, to-h12, to-c22, pc-h9/si-HLJ1-L, and pc-h9/si-HLJ1-A) were seeded onto the Matrigel and incubated overnight. Constitutive and inducible HLJ1 expression systems were established in lung adenocarcinoma cell line CL1-5 by using the pcDNA3 (pc clones) and the tetracycline (Tet)-Off (to clones) expression systems, respectively. The pc-h9 and pc-h12 clones are CL1-5 cells constitutively express HLJ1; and pc-c5 and pc-c10 are mock transfectants of CL1-5 cells. The to-h12 is a HLJ1 Tet-off expression CL1-5 cell clone and to-c22 is mock transfectant. The next day, membranes coated with Matrigel were swabbed with cotton, fixed with methanol, and stained with 20% Giemsa solution (Sigma Chemical, St. Louis, MO). The cells that were attached to the lower surface of the polycarbonate filter were counted under a light microscope (x200 magnification). The experiments were performed three times in triplicate.
Migration Assay
Cells (2.5 x 105 each of CL1-5, pc-h9, pc-c10, pc-h9/si-HLJ1-L and pc-h9/si-HLJ1-A) were seeded into 6-cm culture dishes and grown in medium containing 10% FBS to nearly confluent cell monolayers, which were then carefully scratched using a 10-µL pipette tip. Cellular debris was removed by washing with PBS. After wounding by scratching, the cultures were incubated at 37 °C and photographed immediately (t = 0) and 2 and 4 hours later. The number of cells that migrated into the cell-free zone was evaluated. The experiments were performed three times in triplicate.
Cell Proliferation and Anchorage-Independent Growth Assay
Cells from each clonal line (CL1-5, pc-c10, pc-c5, pc-h9, and pc-h12) were seeded onto 96-well plates (3 x 103 cells/well, 1 plate per cell line). After culturing for various durations, cell proliferation was evaluated by thiazolyl blue tetrazolium bromide (MTT) assay according to the manufacturer's protocol (Chemicon). In brief, 10 µL of the MTT solution (5 mg/mL) was added to each well, the cells were cultured for another 4 hours at 37 °C, and 100 µL of 0.04 N HCl in isopropanol was added to each well and mixed vigorously to solubilize colored crystals produced within the cells. The absorbance at 570 nm (630 nm as the reference) was measured by using a multiwell scanning spectrophotometer Victor3 (Perkin-Elmer, Boston, MA). Experiments were performed three times in triplicate.
To determine anchorage-independent growth, six-well plates were precoated with 0.6% agarose in RPMI-1640 with 10% FBS, and cells (CL1-5, pc-c10, pc-h9, and pc-h12) were seeded at 6 x 103 cells per well in 0.3% agarose/RPMI-1640 with 10% FBS. The plates were incubated for 2 weeks and then stained with 0.5% crystal violet. Colonies with a diameter greater than 1 mm were counted under an inverted microscope. Soft agar colony formation was assessed in three independent experiments in triplicate.
Tumor Growth In Vivo
Six-week-old severe combined immunodeficiency (SCID) mice (supplied by the animal center in the College of Medicine, National Taiwan University, Taipei, Taiwan) were housed at six mice per cage and fed ad libitum with autoclaved food. The HLJ1-transfected (pc-h9 and to-h12) or mock-transfected (pc-c10 and to-c22) cells (5 x 106) were incubated in Trypsin–EDTA (0.05% Trypsin, 0.53 mM EDTA 
4Na; Invitrogen), washed in PBS, centrifuged (2500g for 5 minutes at 4 °C), resuspended in Hanks' balanced salt solution (Life Technologies), and were injected subcutaneously into the dorsal region of SCID mice. Injected mice were examined every 5 or 7 days for tumor appearance, and tumor volumes were estimated from the length (a) and width (b) of the tumors, as measured by calipers, using the formula V = ab2/2 (26). Mice injected with either pc-h9 or to-h12 cells developed tumors approximately 28 days after inoculation. Tumor volumes were compared at day 33 after inoculation for tumors derived from transfected cells (pc-h9 versus pc-c10) and at day 35 for tumors derived using the Tet-off system (to-h12 versus to-c22). Mouse experiments were approved by Laboratory Animal Center, National Taiwan University College of Medicine.
Patients and Tissue Specimens
Lung tumor tissue and adjacent normal tissue specimens were obtained from 71 patients with histologically confirmed NSCLC who underwent surgical resection at the Taichung Veterans General Hospital between November 11, 1999, and November 8, 2001. To further evaluate the robustness of HLJ1 expression in the prediction of patient prognosis, the model was validated in an independent cohort of 56 NSCLC patients who underwent surgical resection at the Taichung Veterans General Hospital between December 3, 2001, and December 25, 2003. These two sets of patients were collected in a continuous and nonbiased way during the entire testing period, and none of the patients had received preoperative adjuvant chemotherapy or radiation therapy. This investigation was approved by the institutional review board of the Taichung Veterans General Hospital. Written informed consent was obtained from all patients. The postsurgical pathologic stage of each tumor was classified according to the international tumor–node–metastasis classification (4). The clinical and pathologic features of the patients and tissues are shown in Supplementary Tables 1 and 2 (available at http://jncicancerspectrum.oxfordjournals.org/jnci/content/vol98/issue12).
Quantitative Reverse Transcription–PCR
The expression level of HLJ1 was detected by real-time PCR on an ABI prism 7900 sequence detection system (Applied Biosystems), according to the manufacturer's instructions. The HLJ1 primers are as follows: forward primer QHLJ1-F, 5'-CCAGCAGACATTGTTTTTATCATT-3'; and reverse primer QHLJ1-R, 5'-CCATCCAGTGTTGGTACATTAATT-3'. The probe sequence used to detect and quantify the real-time PCR product is FAM-5'-ATTAGTTTACGAGAGGCATTGTGTGGC -TG-3'-TAMRA. TATA box–binding protein (TBP) was used as the internal control (GenBank X54993). The primers and probe used for quantitative RT–PCR of TBP mRNA were as described previously (27,28). The relative expression level of HLJ1 compared with that of TBP was defined as –
CT = – [CTHLJ1 – CTTBP]. The HLJ1 mRNA/TBP mRNA ratio was calculated as 2–CT x K, in which K is a constant. Experiments were performed three times in triplicate. The median HLJ1 expression in tumor specimens from 71 patients (HLJ1/TBP ratio = 0.66) was used as the cutoff point to define high HLJ1 and low HLJ1 expression groups.
Loss of Heterozygosity Analysis
Laser capture microdissection was performed in tumors and in normal lung tissues (at the section margin) to obtain a homogeneous population of tumor cells. Dissected tissues were immediately stored in liquid nitrogen, and genomic DNA was extracted using conventional proteinase K and phenol–chloroform extraction followed by ethanol precipitation (29). Forty-eight pairs of microdissected tumor cells and corresponding normal tissues were used for loss of heterozygosity (LOH) mapping. Detailed procedures for the LOH analysis were described previously (29,30). In brief, the fluorescent dye–labeled microsatellite markers D1S1665 (forward primer: TAAGTAAGTTCAAATTCATCAGTGC; reverse primer: TTCCAAGCTTCACAGTGTCA) and D1S1728 (forward primer: TAGGCAAATAATAAAATTCTAACCA; reverse primer: GACCCTGTCTCAAAAAAAACA) located on 1p31.1 were purchased from PE Applied Biosystems (Foster City, CA). The HLJ1 marker is 4.23 Mb away from D1S1665 and 3.5 Mb away from D1S1728. Five nanograms of genomic DNA was used for each PCR analysis. PCR products with different fluorescent dyes and fragment sizes were pooled and mixed with internal fluorescent molecular weight markers for subsequent electrophoresis in an ABI 377 automated fluorescent DNA sequencer (PE Applied Biosystems), and the fluorescence signals from the different-sized alleles were recorded and analyzed using Genotyper version 2.1 and Genescan version 3.1 software. The allelic ratio was calculated as (T1/T2)/(N1/N2) for the ratio of area values of the tumor (T) versus the normal (N) alleles. LOH was defined as an allelic ratio more than 2 or less than 0.5. Therefore, LOH was defined as a reduction of 50% or more in the peak intensity of one of the tumor sample alleles when compared with a heterozygous normal tissue control. All experiments were performed at least two times in duplicate.
Oligonucleotide Microarray Analysis
Total RNA was isolated from CL1-5, pc-c10, and pc-h9 cells using Trizol reagent (Life Technologies). cRNA preparation and array hybridization were performed according to the Affymetrix GeneChip Expression Analysis Technical Manual. In brief, 8 µg of total RNA was reverse-transcribed in the presence of a T7-(dT)24 primer (One-cycle cDNA Synthesis kit; Affymetrix, Santa Clara, CA). The cDNA product was purified and then transcribed in vitro with biotin-labeled ribonucleotides (IVT Labeling Kit; Affymetrix). A portion of the biotinylated RNA was fragmented and hybridized overnight to human genome U133 plus 2.0 array (Affymetrix). The GeneChip was washed and developed by the amplification staining protocol provided by Affymetrix. The GeneChip was scanned with an Affymetrix GeneChip Scanner 3000, and the results were analyzed with Affymetrix GeneChip Operating Software (GCOS) version 1.0 (MAS 5.0). The statistical analysis logic and algorithms used are described in the Affymetrix manual. We used SYBR Green real-time RT–PCR to confirm the results derived from microarray analysis. The primer sets used are listed in Supplementary Table 3 (available at http://jncicancerspectrum.oxfordjournals.org/jnci/content/vol98/issue12) and the detailed procedures have been described previously (31). All experiments were performed three times in triplicate.
P21WAF1 Expression
The pCEP4-P53 plasmid expressing the wild-type P53 was constructed in our previous study (32). The pCEP4-P53 and pcDNA3-HLJ1 plasmids were transiently transfected into p53-null NSCLC H1299 cells by using the Lipofectamine reagent (Invitrogen). After 24 hours, cells were harvested for SYBR Green real-time PCR and western blot analysis. All of the experiments were performed three times in triplicate.
Flow Cytometry
The parental CL1-5 and transfected pc-c10 and pc-h9 cells were seeded at a density of 106 cells/100-mm dish in medium with 10% FBS for 48 hours and then harvested. Each sample was washed with ice-cold PBS, harvested and fixed in 70% (vol/vol) ethanol for 30 minutes. The cells were then treated with RNase A and stained with 25 µg/mL propidium iodide. The samples were analyzed by flow cytometry using a FACScan flow cytometer (Becton Dickinson) according to the manufacturer's protocol. Experiments were performed three times in triplicate.
Cell Synchronization
The synchronization method was modified from that previously reported (33). In brief, cells (CL1-5, pc-c10, pc-h9, pc-h9/si-HLJ1-L, and pc-h9/si-HLJ1-A) were seeded in 100-mm tissue culture dishes at approximately 70%–80% confluence in serum-free medium with 0.5 µg/mL aphidicolin for 24 hours to block the cells in G0/G1. Cells were then incubated in medium supplemented with 10% FBS and 40 ng/mL of Nocodazole until harvest to block the cells at G2/M. The cells were harvested at various time points for DNA content analysis by flow cytometry.
Statistical Analyses
Data are presented as the means and their 95% confidence intervals of at least three experiments. All statistical analyses were performed with the SAS statistical program (version 9.1; SAS Institute, Cary, NC). Groups were compared with Student's t test. The Wilcoxon signed-rank test was used to compare HLJ1 mRNA expression between tumor samples and paired normal tissues. Survival curves were obtained by the Kaplan–Meier method. Disease-free and overall survival of patients with low versus high expression of HLJ1 was analyzed using the log-rank test. To evaluate the robustness of the high–low risk dichotomy based on the cutoff point of median HLJ1 expression, we performed 10 000 permutations under the null hypothesis of no association of high–low risk dichotomy with survival by randomly assigning 71 patients into the two groups. Empirical P was determined by the number of replicates that exceed the observed log-rank test statistic, divided by the total number of replicates (10 000). Multivariable Cox proportional hazards regression was performed, with overall survival or disease-free survival as the response variable. To verify the proportional hazards model assumption, we tested that the hazard ratios for covariates changed with time (including age, sex, stage, histology type, and HLJ1 expression). The result showed that only sex in relapse-free survival was statistically significant (P = .045). However, the hazard ratio for sex changed with time and was of borderline statistical significance. All statistical tests were two sided, and P<.05 was considered to be statistically significant.
|
RESULTS |
|---|
|
TopNotesAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
HLJ1 Expression in Lung Cancer Cell Lines
Expression of HLJ1 mRNA was higher in the less invasive CL1-0 and CL1-1 human lung adenocarcinoma cells than in the highly invasive CL1-5 and CL1-5-F4 lines, as indicated by cDNA microarray (Fig. 1, A). Steady-state HLJ1 mRNA analysis revealed two major HLJ1 transcripts of approximately 2.5 kb and 3.6 kb (Fig. 1, B). Although all cell lines expressed HLJ1, the expression levels were eightfold higher in the less invasive CL1-0 and CL1-1 cells than in the highly invasive CL1-5 and CL1-5-F4 cells, as measured by real-time PCR (Fig. 1, C). HLJ1 protein levels were also markedly higher in the less invasive CL1-0 and CL1-1 cells than in the highly invasive CL1-5 and CL1-5-F4 cells, as shown by western blot analysis (Fig. 1, D).
|
Subcellular Localization of HLJ1 Protein
The transiently expressed EGFP-tagged full length HLJ1 protein was localized in the nuclei and nucleoli of living CL1-5 cells, as observed by laser-scanning confocal microscopy (Fig. 1, E). Consistent with these observations, PSORT II sequence analysis (34) indicated that HLJ1 contains three putative nuclear localization sequences (data not shown).
HLJ1 Expression and Lung Cancer Cell Invasion and Migration
HLJ1 expression in CL1-5 cells using the constitutive expression (pcDNA3) system and the inducible (Tet-Off) expression system was measured using quantitative RT–PCR and western blot analyses (Fig. 2, A and B). Transfected clones expressed higher levels of HLJ1 transcription and translation products than the mock control subjects. Five clones that stably expressed HLJ1 were isolated (pc-h2, pc-h9, pc-h12, pc-h21, and to-h12). The invasive activity of HLJ1 transfectants (pc-h9 and pc-h12) was lower than that of mock-transfected (pc-c5 and pc-c10) or parental CL1-5 cells in the modified Boyden chamber assay (Fig. 2, C). Transfection with HLJ1-specific siRNAs suppressed HLJ1 protein expression and reversed cell invasion ability in pc-h9 cells (Fig. 2, D). Migration of pc-h9 cells was markedly reduced (70%, 95% confidence interval [CI] = 67.4% to 72.5%) compared with that of control subjects (CL1-5 and pc-c10) in the standard scratch wound assay (Fig. 2, E). The migration capability of pc-h9 cells among which HLJ1 expression was knocked down by siRNA was higher than that of control pc-h9 cells (Fig. 2, E).
|
, P<.001, compared with to-c22 mock control. 
, P<.01, compared with pc-h9/siHLJ1-L. P values (two-sided) were determined by Student's t test.HLJ1 Expression and Inhibition of Lung Cancer Cell Proliferation and Anchorage-Independent Growth
HLJ1 transfectants (pc-h9 and pc-h12) proliferated more slowly than mock-transfected (pc-c5 and pc-c10) and parental CL1-5 cells, as shown by MTT assay (Fig. 3, A). For example, after 4 days of culture, the number of pc-h9 cells was 6457 (95% CI = 6223 to 6691) and that of the parental CL1-5 cells was 13 585 (95% CI = 12 959 to 14 211). The inhibitory effect of HLJ1 on anchorage-independent growth was shown by reduced colony formation of HLJ1 transfectants compared with mock cells in the soft agar assay (Fig. 3, B). Increasing the growth time did not increase the colony formation of HLJ1 transfectants (data not shown).
|
HLJ1 Expression and Tumor Growth In Vivo
Tumors derived from CL1-5 cells in which HLJ1 expression was increased by using the constitutive HLJ1 expression and inducible HLJ1 expression systems grew more slowly than tumors derived from control cells in SCID mice (Fig. 3, C). When the constitutive expression system was used, tumors derived from the CL1-5/HLJ1 transfectant (pc-h9) reached 245 mm3 (95% CI = 94 mm3 to 396 mm3) 33 days after inoculation, whereas tumors derived from the CL1-5/vector control (pc-c10) cells reached 3255 mm3 (difference = 3010 mm3, 95% CI = 1992 mm3 to 4518 mm3; P = .004) in mice. Similar results were also obtained using the inducible expression system. In this system, 35 days after inoculation, the volume of the tumors derived from CL1-5/HLJ1 transfectant to-h12 cells increased slightly to 72 mm3 (95% CI = 5 mm3 to 139 mm3), whereas the volume of the tumors derived from the CL1-5/vector control (to-c22) cells was approximately 1009 mm3 (difference = 937 mm3, 95% CI = 549 mm3 to 1469 mm3; P = .006)
HLJ1 Expression in Tumor and Adjacent Normal Tissue of Patients with NSCLC
Primary cancer specimens from 71 patients with histologically confirmed NSCLC were studied. Initially we selected 10 specimens at random and carried out RT–PCR analysis. HLJ1 expression in tumors was lower than in the adjacent normal tissue in all 10 specimens (Fig. 4, A). We then examined all 71 samples using real time RT–PCR. Overall, HLJ1 expression in tumors was lower (difference = –0.89, 95% CI = –1.25 to –0.53; P<.001) than that of adjacent normal tissue in 55 (77%) of the 71 patients studied. Moreover, in 49% of the samples, tumor tissues showed at least twofold lower HLJ1 expression than that in adjacent normal tissues.
|
High Frequencies of Allelic Loss on Chromosome Region 1p31.1
We observed frequent LOH at the HLJ1 loci in paired samples of microdissected lung tumor and corresponding normal tissues from 48 patients. Differences in the detection patterns of the microsatellite markers D1S1728 and D1S1665 were observed in 50% (24/48) and in 44% (21/48), respectively, of the samples obtained from lung cancer patients. D1S1728 and D1S1655 showed 66.7% and 70.8% LOH, respectively, in these patients. We also found that the microsatellite instability frequencies of D1S1728 and D1S1665 were 95.2% and 87.5%, respectively, among the 48 patients (Fig. 4, B).
HLJ1 High Expression Versus Low Expression Group of NSCLC Patients
The median HLJ1 expression in tumor specimens from 71 patients (HLJ1/TBP ratio = 0.66) was used as the cutoff point to define high-HLJ1 and low-HLJ1 expression groups. There were no differences in age, sex, stage, tumor status, or lymph node metastasis between the two groups (Supplementary Table 1, available at http://jncicancerspectrum.oxfordjournals.org/jnci/content/vol98/issue12).
HLJ1 Expression and Survival of Patients with NSCLC
Patients with high expression of HLJ1 had longer overall survival (P = .02) and disease-free survival (P = .02) than patients with low expression, as shown by Kaplan–Meier survival analyses and log-rank tests (Fig. 4, C and D). To evaluate the robustness of the high–low risk dichotomy based on the cutoff point of median HLJ1 expression, we performed 10 000 permutations under the null hypothesis of no association of high–low risk dichotomy with survival by randomly assigning 71 patients into the two groups. Patients with a high-risk HLJ1 signature still had poorer overall and disease-free survival than those with low risk (P = .02).
Multivariable Cox proportional hazards regression analyses showed that HLJ1 expression was associated with improved overall survival of NSCLC patients independent of clinicopathologic stage, age, sex, or cell type (patients with high versus low HLJ1 expression, hazard ratio [HR] = 0.38, 95% CI = 0.16 to 0.89; P = .03). Similarly, disease-free survival was associated only with expression of HLJ1 (patients with high versus low HLJ1 expression, HR = 0.47, 95% CI = 0.23 to 0.93; P = .03) and clinicopathologic stage (patients with stage III versus stage I and II, HR = 4.03, 95% CI = 2.02 to 8.05; P<.001). To examine whether the association between HLJ1 expression and survival prognosis was modified by clinicopathologic stage, we performed multivariable Cox proportional hazards regression analyses with stepwise selection. No interaction between HLJ1 expression and clinicopathologic stage was observed.
To validate these findings, we examined an independent cohort of 56 NSCLC patients. The patients with high expression (as defined by the median in the original cohort) of HLJ1 had longer overall survival (P = .02) and disease-free survival (P = .01) than patients with low expression (Fig. 4, E and F). Also, multivariable Cox proportional hazards regression analyses showed that HLJ1 expression (patients with high versus low HLJ1 expression, HR = 0.37, 95% CI = 0.14 to 0.97; P = .04) and clinicopathologic stage (patients with stage III versus stage I and II, HR = 2.57, 95% CI = 1.06 to 6.22; P = .04) were associated with overall survival of this cohort of NSCLC patients, independent of age, sex, or cell type. Moreover, disease-free survival in this cohort was associated with expression of HLJ1 (HR = 0.38, 95% CI = 0.17 to 0.85; P = .02) and clinicopathologic stage (HR = 2.97, 95% CI = 1.39 to 6.32; P = .005). Also consistent with results among the test set of patients, multivariable analyses showed no association between expression of HLJ1 and disease stage in the independent validation set of patients.
Identification of HLJ1 Downstream Genes by Microarray Analysis
Affymetrix oligonucleotide microarray analysis was performed to determine whether any genes were differentially expressed among CL1-5/HLJ1 (pc-h9) and CL1-5/vector control (pc-c10). A total of 1240 genes showed least twofold changes in expression levels between the CL1-5/HLJ1 and CL1-5/vector control. Differences in expression of the genes related to cell cycle, growth, invasion, and adhesion were validated by SYBR Green real-time PCR (Table 1). The snail homologue 2, high-mobility group AT-hook 2, caldesmon 1, and CD44 genes were suppressed in pc-h9 cells, whereas signal transducer and activator of transcription, P21WAF1, cyclin G2, thioredoxin interacting protein, tissue inhibitor of matrix metalloproteinase-3, interferon-stimulated transcription factor 3 gamma subunit, interferon-induced protein with tetratricopeptide repeats 1, 2'-5'-oligoadenylate synthetase 3, and interferon induced transmembrane protein 1 were stimulated by HLJ1 expression. Our in-house data mining tool (http://biochip.nchu.edu.tw/SpecificDB_01/) revealed that the JAK/STAT1 signaling pathway and cell cycle progression were regulated by HLJ1 expression (Fig. 5).
|
|
= interferon beta; IFNGR1 = interferon gamma receptor 1; IFNGR2 = interferon gamma receptor 2; Jak1 = Janus kinase 1; Jak2 = Janus kinase 2; Tyk2 = tyrosine kinase 2; STAT1 = signal transducer and activator of transcription 1; STAT2 = signal transducer and activator of transcription 2; P21WAF1 = cyclin-dependent kinase inhibitor 1A; ISGF3G = interferon-stimulated transcription factor 3 gamma subunit; IFIT1 = interferon-induced protein with tetratricopeptide repeats 1; IFITM1 = interferon induced transmembrane protein 1; OAS3 = 2'-5'-oligoadenylate synthetase 3; G1P2 = interferon alpha–inducible protein 15; IFIT3 = interferon-induced protein with tetratricopeptide repeats 3; GAS = gamma interferon–activated sequence; ISRE = interferon-stimulated responsive element; encircled P = phosphorylated; dotted lines with arrows indicate the points in pathways in which HLJ1 acts; solid lines with arrows show interactions between the pathways; boldface arrows indicate increases in gene expression.HLJ1, the STAT1 and P21WAF1 Pathway, and Cyclin D1
We next used western blot analyses to investigate how HLJ1 regulates cell cycle progression. HLJ1-expressing cells showed increased expression of STAT1 and P21WAF1 and decreased expression of cyclin D1 (Fig. 6, A). Also, STAT1 tyrosine phosphorylation, a prerequisite for the protein's dimerization and DNA binding, was notably increased in HLJ1 transfectants. To investigate the effects of IFN on HLJ1 expression, CL1-CL1-5 cells were pretreated with IFN- and IFN- for 18 hours. HLJ1 protein expression was not increased by IFN treatment (Fig. 6, B). However, p21WAF1 expression was decreased when HLJ1 expression was knocked down (Fig. 6, C) in CL1-5/HLJ1 (pc-h9) cells by using HLJ1 siRNAs.
|
P53 and Regulation of P21WAF1 by HLJ1
Our results indicated that HLJ1 can increase the expression of P21WAF1 in the-CL1-5 cell line, which is a P53 mutant that contains the arginine-to-tryptophan substitution R248
W. This finding suggested that HLJ1 can increase P21WAF1 expression through a P53-independent pathway. To determine whether increased P21WAF1 expression by HLJ1 is P53 independent, the P53-null cell line (H1299) was used. SYBR Green real-time RT–PCR and western blot analysis showed that the expression of P21WAF1 was increased in H1299 cells transfected with HLJ1 (Fig. 6, D and E). We also transiently transfected the pCEP4-P53 plasmid expressing the wild-type P53 into H1299 cells and found that P21WAF1 expression was highly increased, whereas HLJ1 expression was not (Fig. 6, F).
HLJ1 Expression and Suppression of Cell Cycle Progression
Flow cytometry analyses showed that HLJ1 expression can delay entry into S phase. Cells (CL1-5, pc-c10, and pc-h9) were seeded and cultured in medium with 10% FBS for 48 hours and then harvested for flow cytometry analyses. A greater percentage of CL1-5/HLJ1 (pc-h9) cells (50.4%, 95% CI = 45.9% to 54.9%) remained in G0/G1 than CL1-5 (36.0%, 95% CI = 33.8% to 38%) and pc-c10 cells (36.8%, 95% CI = 34.5% to 39.1%) (Fig. 7, A). Parental CL1-5 and CL1-5/vector control pc-c10 cells entered S phase within 2–4 hours after the removal of aphidicolin, a drug used to arrest cells at G1/S boundary, compared with 4–6 hours for HLJ1 transfected pc-h9 cells (Fig. 7, B). The suppression of cell cycle progression that was observed in pc-h9 cells was reversed by transfection with HLJ1-specific siRNAs. Specifically, the knockdown of the HLJ1 expression in pc-h9 cells resulted in entry into S phase within 2–4 hours after the removal of aphidicolin, comparable to that of the CL1-5/vector control pc-c10 cells (Fig. 7, C).
|
|
DISCUSSION |
|---|
|
TopNotesAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Results of this study show that HLJ1 is a tumor suppressor in NSCLC. Restoration of HLJ1 expression in NSCLC cells inhibited cell proliferation, anchorage-independent growth, cell motility, invasion, and tumorigenesis. Microarray and pathway analysis identified a novel tumor suppressor mechanism in that HLJ1 activated the STAT1 and P21WAF1 pathways can inhibit cell cycle progression. The activation of the STAT1 pathway by HLJ1 was independent of P53 and extracellular signals, such as IFN-
and -. HLJ1 suppression of cell cycle progression through STAT1 and P21WAF1 was reversed by the inhibition of HLJ1 expression by siRNAs. Increased HLJ1 expression was associated with prolonged disease-free and overall survival of patients with NSCLC. These clinical results were confirmed in an independent cohort of NSCLC patients. The issue of false positives encountered in studies of this kind is important. Although our selection of HLJ1 for further characterization was based on the expression pattern revealed from previous microarray analysis (9), the difference in expression we observed could still have been due to chance. In this study, we verified HLJ1 expression by using three different kinds of biological assay, i.e., northern blotting, real-time RT–PCR (both for RNA level), and western blotting (for protein level) in cell lines. Furthermore, the prognostic utility of HLJ1 was assessed with two safeguards, first with an empirical P value estimated by performing 10 000 permutations and then with validation in an independent cohort of the NSCLC patients. These additional analyses should enhance the robustness of our findings reported here, although they still do not rule out the possibility of false-positive results.
Downstream gene analysis using microarray techniques indicated that HLJ1 modulated many genes, including those that encode transcription factors, signal transduction, suppression of cell proliferation, cell cycle, invasion, migration, angiogenesis and other tumor suppressor genes. HLJ1 may also have some metastasis suppressor function, as suggested by the suppression of some genes associated with cell invasion and metastasis, as well as the inhibition of cell invasion and migration in vitro. These data are consistent with our recent findings that increased HLJ1 expression can reduce expression of the SLUG gene, a member of the snail family of zinc finger transcription factors, and increase E-cadherin expression, effects that are associated with the inhibition of cell invasion and metastasis (35).
The microarray and pathway analyses also indicated that JAK/STAT1 and cell cycle progression pathways are involved in the downstream regulation of HLJ1 expression. We further found that HLJ1 slows cell cycle progression by increasing STAT1 and P21WAF1 expression and by decreasing cyclin D1 expression. STAT1 appears to explain the tumor suppressor effect of HLJ1. Amounts of both STAT1 and tyrosine-phosphorylated STAT1 were notably increased by HLJ1. STAT1 is a checkpoint protein that can cause growth arrest and apoptosis in many cell types through the activation of P21WAF1 and caspase expression (36–38). STAT1 can also interact with P53 and modulate cell response to genotoxic stress–induced apoptosis (38). In our analysis, we found that some genes whose expression has previously been reported as being increased by STAT1 were also regulated by HLJ1, including P21WAF1, ISGF3G, IFIT1, IFITM1, OAS3, and G1P2.
Recently, STAT1 has been implicated as a novel regulator of apoptosis and as a tumor suppressor (39). We observed that HLJ1 can decrease expression of cyclin D1, as has also been observed in studies of other tumor suppressors, such as ras association domain family protein 1 (RASSF1), kruppel-like factor 6 (KLF6), and TP53 (40–42). The increased expression of P21WAF1 and decreased expression of cyclin D1 can slow cell cycle progression and tumor cell growth (36,43).
Our data indicated that HLJ1 increases STAT1 expression independent of IFN- and -. This is the first observation, to our knowledge, that suggests that STAT1 can be regulated in the absence of extracellular signaling molecules. STAT1 can be activated endogenously by stress-inducible proteins, such as HLJ1, and can modulate cell proliferation, tumorigenesis, and immunologic responses. Recent reports indicate that STAT1 can modulate P53, and it is through P53 signaling that STAT1 can induce apoptosis and cell cycle arrest (39). CL1-5 cells are P53-mutant (R248W). Hence, it is unlikely that HLJ1 increases STAT1 and P21WAF1 and slows cell cycle progression in HLJ1-transfected CL1-5 cells by the normal P53 protein pathway. Expression of P21WAF1 is activated by wild-type P53 but not by the R248W mutant (44). We also observed that the expression of P21WAF1 was increased by HLJ1 in P53-null (H1299) cells and that HLJ1 was not regulated by wild-type P53 (Fig. 6). Thus, our results suggest that HLJ1 can increase P21WAF1 expression through a P53-independent pathway.
Tumor suppressor genes are frequently inactivated by genetic alterations, such as chromosomal deletions and loss-of-function mutations (45,46). Several areas of frequent allelic loss have been found in lung cancer, and frequent allelic loss at chromosome region 1p31.1, the location of HLJ1 gene, has been detected in NSCLC patients (>50%) (47). LOH on the short arm of chromosome 1 has also been reported in many other cancer types (48). Our LOH mapping results using microdissected NSCLC tumors confirmed the high frequencies of LOH and microsatellite instability at chromosome region 1p31.1 in NSCLC observed in the previous studies.
NSCLC is a heterogeneous disease, and NSCLC patients with similar clinical–pathologic features have a broad range of outcomes. Because the current clinical staging systems for lung cancer may have reached their limits in predicting clinical outcome, new prognostic markers to identify patients at high risk of postsurgical recurrence are urgently needed. The association of HLJ1 expression and cancer recurrence and survival of NSCLC patients may have important clinical implications in this respect; e.g., effective adjuvant therapy for NSCLC patients with resected tumors was recently reported (49). The identification and selection of patients with high risk of cancer recurrence for adjuvant therapy may improve the result of treated patients and spare the low-risk patients from unnecessary treatment.
The study has several potential limitations. Although the data in this study strongly suggest that HLJ1 is a tumor suppressor, whether it has this function in cancer types other than NSCLC is unknown. The use of a Chinese NSCLC patient population in this study should be noted because NSCLC in Chinese patients, especially women, may exhibit clinical–pathologic characteristics that are different from NSCLC in white patients (50). Also, the patient sample size of this study is relatively small. Therefore, further confirmation of the clinical utility of HLJ1 as an independent predictor of cancer recurrence and patient outcome by large scale multicenter international clinical trials, including white and Asian patients, is recommended.
The identification of a tumor suppressor that can predict clinical outcomes in patients and the delineation of its mechanism of action may have implications for future development of targeted therapy for lung cancer. HLJ1 is a heat shock stress protein; invasive NSCLC cells with reduced HLJ1 expression cannot generate heat shock responses under stress (data not shown). These results may have important clinical implications. Chemotherapy may be an extreme form of stress for cancer cells. Cancer cells with reduced HLJ1 expression may have a survival disadvantage under stress because they cannot express or activate proteins that are essential for cellular viability under extreme stress. Whether reduced HLJ1 expression in cancer cells is a predictor of response to chemotherapy is not clear.
In conclusion, we found that HLJ1 is a novel tumor suppressor in NSCLC. HLJ1 expression lowered cyclin D1 expression, increased STAT1 and p21WAF1 expression, and affected many STAT1 pathway downstream genes. HLJ1 expression was also associated with improved disease-free and overall survival in NSCLC patients. These findings may identify a subgroup of high-risk NSCLC patients who may benefit from adjuvant therapy and facilitate the design of individualized therapies for lung cancer.
|
NOTES |
|---|
|
TopNotesAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Supported by the National Science Council, National Health Research Institutes, and Department of Health, Executive Yuan of the Republic of China through the National Research Program for Genomic Medicine Grants (NHRI93A1-NSCLC09-5, DOH94-TD-G-111-019, and DOH95-TD-G-111-009). The funding agency had no role in the study design, data collection, analysis, interpretation of the data, or the preparation of this report.
M.-F. Tsai, C.-C. Wang, and G.-C. Chang contributed equally to this work and should be considered joint first authors.
We thank the Microarray Core Facility for Genomic Medicine (supported by the National Research Program for Genomic Medicine, NSC) for the microarray analysis and technical support.
|
REFERENCES |
|---|
|
TopNotesAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
(1) Parkin DM, Bray FI, Devesa SS. Cancer burden in the year 2000. The global picture. Eur J Cancer 2001;37:S4–66.
(2) Jemal A, Thomas A, Murray T, Thun M. Cancer statistics, 2002. CA Cancer J Clin 2002;52:23–47.
(3) Hoffman PC, Mauer AM, Vokes EE. Lung cancer. Lancet 2000;355:479–85.[ISI][Medline]
(4) Mountain CF. Revisions in the International System for Staging Lung Cancer. Chest 1997;111:1710–7.
(5) Naruke T, Goya T, Tsuchiya R, Suemasu K. Prognosis and survival in resected lung carcinoma based on the new international staging system. J Thorac Cardiovasc Surg 1988;96:440–7.[Abstract]
(6) Herbst RS, Yano S, Kuniyasu H, Khuri FR, Bucana CD, Guo F, et al. Differential expression of E-cadherin and type IV collagenase genes predicts outcome in patients with stage I non-small cell lung carcinoma. Clin Cancer Res 2000;6:790–7.
(7) Moldvay J, Scheid P, Wild P, Nabil K, Siat J, Borrelly J, et al. Predictive survival markers in patients with surgically resected non-small cell lung carcinoma. Clin Cancer Res 2000;6:1125–34.
(8) Beer DG, Kardia SL, Huang CC, Giordano TJ, Levin AM, Misek DE, et al. Gene-expression profiles predict survival of patients with lung adenocarcinoma. Nat Med 2002;8:816–24.[ISI][Medline]
(9) Chen JJW, Peck K, Hong TM, Yang SC, Sher YP, Shih JY, et al. Global analysis of gene expression in invasion by a lung cancer model. Cancer Res 2001;61:5223–30.
(10) Shih JY, Yang SC, Hong TM, Yuan A, Chen JJW, Yu CJ, et al. Collapsin response mediator protein-1 and the invasion and metastasis of cancer cells. J Natl Cancer Inst 2001;93:1392–400.
(11) Shih JY, Tsai MF, Chang TH, Chang YL, Yuan A, Yu CJ, et al. Transcription repressor slug promotes carcinoma invasion and predicts outcome of patients with lung adenocarcinoma. Clin Cancer Res. 2005;11:8070–8.
(12) Hoe KL, Won M, Chung KS, Jang YJ, Lee SB, Kim DU, et al. Isolation of a new member of DnaJ-like heat shock protein 40 (Hsp40) from human liver. Biochim Biophys Acta 1998;1383:4–8.[CrossRef][Medline]
(13) Morimoto RI. Cells in stress: transcriptional activation of heat shock genes. Science 1993;259:1409–10.
(14) Jolly C, Morimoto RI. Role of the heat shock response and molecular chaperones in oncogenesis and cell death. J Natl Cancer Inst 2000;92:1564–72.
(15) Csermely P, Schnaider T, Soti C, Prohaszka Z, Nardai G. The 90-kDa molecular chaperone family: structure, function, and clinical applications. A comprehensive review. Pharmacol Ther 1998;79:129–68.
(16) Kiang J, Tsokos G. Heat shock protein 70 kDa: molecular biology, biochemistry, and physiology. Pharmacol Ther 1998;80:183–201.[CrossRef][ISI][Medline]
(17) Lindquist S, Craig EA. The heat shock proteins. Annu Rev Genet 1988;22:631–77.[CrossRef][ISI][Medline]
(18) Robert J. Evolution of heat shock protein and immunity. Dev Comp Immunol 2003;27:449–64.[CrossRef][ISI][Medline]
(19) Helmbrecht K, Zeise E, Rensing L. Chaperones in cell cycle regulation and mitogenic signal transduction: a review. Cell Prolif 2000;33:341–65.[CrossRef][ISI][Medline]
(20) Neininger A, Gaestel M. Evidence for a hsp25-specific mechanism involved in transcriptional activation by heat shock. Exp. Cell Res 1998;242:285–93.[CrossRef][ISI][Medline]
(21) Kurzik-Dumke U, Gundacker D, Renthrop M, Gateff E. Tumor suppression in Drosophila is causally related to the function of the lethal (2) tumorous imaginal discs gene, a dnaJ homolog. Dev Genet 1995;16:64–76.[CrossRef][ISI][Medline]
(22) Schilling B, De-Medina T, Syken J, Vidal M, Munger K. A novel human DnaJ protein, hTid-1, a homolog of the Drosophila tumor suppressor protein Tid56, can interact with the human papillomavirus type 16 E7 oncoprotein. Virology 1998;247:74–85.[CrossRef][ISI][Medline]