© 2005 Oxford University Press
ARTICLE |
Contribution of hMTH1 to the Maintenance of 8-Oxoguanine Levels in Lung DNA of NonSmall-Cell Lung Cancer Patients
bieta Speina
ska
ski
aw T. Ku
mierek
Affiliations of authors: Department of Molecular Biology, Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Pawi
skiego 5a, 02-106 Warsaw, Poland (ES, KDA, MZ, BT, JTK); Department of Clinical Biochemistry (DG, AS, RO) and Department and Clinic of Thoracic Surgery and Tumours (JK), The Ludwik Rydygier Medical University in Bydgoszcz, Kar
owicza 24, 85-092 Bydgoszcz, Poland
Correspondence to: Jaros
aw T. Ku
mierek, Ph.D., Department of Molecular Biology, Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Pawi
skiego 5a, 02-106 Warsaw, Poland (e-mail: jareq{at}ibb.waw.pl).
| ABSTRACT |
|---|
|
|
|---|
Background: The level of 8-oxoguanine (8-oxoG), a general marker of oxidative DNA damage, in DNA is the result of both an equilibrium between the rates of its formation and removal from DNA by DNA repair enzymes and the removal of 8-oxodGTP from the cellular nucleotide pool by hydrolysis to 8-oxodGMP, preventing its incorporation into DNA. To determine the contribution of each component to the level of 8-oxoG in DNA, we compared 8-oxoGexcising activity (encoded by hOGG1), 8-oxodGTPase activity (encoded by hMTH1), and 8-oxoG levels in DNA from tumors and surrounding normal lung tissues from nonsmall-cell lung cancer patients. Methods: We measured the level of 8-oxoG in DNA of 47 patients by high-performance liquid chromatography/electrochemical detection (HPLC/ECD), hOGG1 activity in tissue extracts of 56 patients by the nicking assay using an oligodeoxynucleotide containing a single 8-oxoG, and hMTH1 activity in tissue extracts of 33 patients by HPLC/UV detection. All statistical tests were two-sided. Results: The 8-oxoG level was lower in tumor DNA than in DNA from normal lung tissue (geometric mean: 5.81 versus 10.18 8-oxoG/106 G, geometric mean of difference = 1.75; P<.001). The hOGG1 activity was also lower in tumor than in normal lung tissue (geometric mean: 8.76 versus 20.91 pmol/h/mg protein, geometric mean of difference = 2.39; P<.001), whereas the hMTH1 activity was higher in tumor than in normal lung tissue (geometric mean: 28.79 versus 8.94 nmol/h/mg protein, geometric mean of difference = 0.31; P<.001). The activity of hMTH1 was three orders of magnitude higher than that of hOGG1 (nanomoles versus picomoles per hour per milligram of protein, respectively). Conclusions: Several different components contribute to the maintenance of 8-oxoG levels in human DNA, with the greatest contributor being the removal of 8-oxodGTP from the cellular nucleotide pool by hMTH1.
| INTRODUCTION |
|---|
|
|
|---|
Cellular DNA and its deoxynucleoside-5'-triphosphate (dNTP) precursors are continuously exposed to reactive oxygen species that are generated by mitochondrial respiration and inflammation and by environmental exposures to ionizing radiation and certain chemicals. Oxidative stress increases the level of oxidative damage to cellular components, including DNA. Because cells, in response to oxidative DNA damage, can repair the damage, replicate it, or activate cell death pathways, oxidative DNA damage has been implicated to play a role in various diseases, including cancer, atherosclerosis, neurodegenerative diseases, and acquired immunodeficiency syndrome (13). Reactive oxygen species modify DNA bases, and more than 20 different oxidatively altered purines and pyrimidines have been detected and characterized (4). Among the modified bases, 8-oxo-7,8-dihydroguanine (8-oxoguanine or 8-oxoG) is one of the most common and is often considered a general marker of oxidative damage to DNA (1,5).
Cytosine and adenine bases can pair with 8-oxoG during DNA synthesis when 8-oxoG is present in the DNA template (6) or when 8-oxodGTP is incorporated into DNA from the nucleotide pool during de novo DNA synthesis (7). The 8-oxoG:A mispair formed by the incorporation of dATP opposite 8-oxoG results in a GC
TA transversion, whereas the A:8-oxoG mispair formed by the incorporation of 8-oxodGTP opposite A results in a AT
CG transversion. In Escherichia coli, at least three repair enzymes are involved in correcting the mispairings. Two of the enzymes involved are DNA glycosylases; the MutM (Fpg) protein excises 8-oxoG from 8-oxoG:C mispairs, and the MutY protein excises adenine from 8-oxoG:A mispairs. A third enzyme, MutT, is a pyrophosphohydrolase (i.e., 8-oxodGTPase) that hydrolyzes 8-oxodGTP to 8-oxodGMP and inorganic pyrophosphate, thus eliminating this damaged dGTP from the dNTP pool and preventing it from being incorporated into DNA (8). Recently, an additional 8-oxoGexcising activity, endonuclease VIII (Nei), was isolated from E. coli. Nei was originally discovered as a DNA glycosylase that specifically excises damaged pyrimidines (9). Whereas MutM preferentially excises 8-oxoG paired in DNA with C, T, and G, Nei preferentially excises 8-oxoG from the 8-oxoG:A mispair.
Human cells contain enzymes that are analogous to the E.coli MutM, Nei, MutY, and MutT proteins. The human enzymes include two 8-oxoG glycosylases, OGG1 and OGG2. hOGG1 specifically excises 8-oxoG from the 8-oxoG:C mispair (10) and is similar in function to MutM. hOGG2 specifically excises 8-oxoG from 8-oxoG:G or 8-oxoG:A mispairs (11) and is similar in function to Nei. Hazra et al. (12) postulated that OGG1 is a housekeeping enzyme that removes 8-oxoG from the DNA of nondividing cells and that OGG2 is more specific, removing 8-oxoG from nascent or transcriptionally active DNA. Two Nei-like human glycosylases, NEIL1 and NEIL2, have been characterized, both of which have specific activity for oxidized pyrimidines, but both can also excise 8-oxoG. These glycosylases can excise oxidized bases from both double-stranded and single-stranded DNA (13,14). The human glycosylase MYH, which is analogous to bacterial MutY, has been also identified and characterized (1517). Similarly, the human enzyme MTH1, which is analogous to MutT protein of E. coli, removes 8-oxodGTP from the cellular dNTP pool (7,18,19). Human MTH1, in contrast to bacterial MutT, acts also on some other oxidative stress-generated dNTPs, e.g., 2-oxo- and 8-oxodATP (20) and 8-chlorodGTP, a hypochlorous acidmodified nucleotide (21). In addition, oxidative DNA damage, including that associated with 8-oxoG, can be repaired by general cellular repair systems: nucleotide excision repair, both transcription-coupled and global genomic systems, and mismatch repair [reviewed in (22)].
Increased DNA damage resulting from oxidative stress has been suggested to play an important role in the induction and progression of many types of human cancers (2,3). The etiology of lung cancer has been linked to tobacco smoking. Cigarette smoke contains many carcinogens, including polycyclic aromatic hydrocarbons, which can form DNA adducts in lung tissue (23), and reactive oxygen species, which can induce oxidative damage in human lung tissue (24). Cigarette smoke can also cause chronic lung inflammation, which increases the oxidative stress in lung tissues (25).
We (26) and Paz-Elizur et al. (27) have recently demonstrated that a deficiency of 8-oxoGexcising activity, as measured in leukocytes of lung cancer patients and healthy volunteers, may be a risk factor for developing lung cancer. In our work, we found that, coincident with decreased 8-oxoGexcising activity, the level of 8-oxoG in DNA isolated from leukocytes of cancer patients was statistically significantly higher than that in DNA of healthy control subjects (26). We have also shown that a deficiency of the excision of lipid peroxidation-generated 1,N6-ethenoadenine and 3,N4-ethenocytosine is associated with the risk of developing lung adenocarcinoma (ADC) (28).
The level of 8-oxoG in DNA reflects the equilibrium of several processes: the rates of 8-oxoG formation in DNA and its elimination from DNA and the rates of 8-oxodGTP formation in and elimination from the cellular nucleotide pool and its incorporation into DNA. Although a number of enzymatic pathways can be involved in removal of 8-oxoG from genomic DNA, it appears that OGG1 plays an essential role in the repair of this lesion in mammalian cells. The evidence comes from experiments with OGG1 gene knockout mice, which accumulate abnormal levels of 8-oxoG in their DNA and have increased spontaneous rate of mutations (29,30). It is interesting that, although extracts of OGG1 null mouse tissues cannot excise 8-oxoG, as assayed by nicking an 8-oxoG-containing oligodeoxynucleotide, there is slow but substantial removal of 8-oxoG from DNA in proliferating cells in vivo. This "backup" repair of 8-oxoG lesions may occur via the nucleotide excision repair pathway (29).
The role of elimination of the mutagen-damaged dNTPs from the cellular pool in the maintenance of genomic integrity has received less attention than the role of genomic DNA repair pathways. However, numerous lines of evidence indicate that eliminating mutagen-damaged dNTPs from the cellular pool is important for maintaining genomic integrity. For example, in E.coli, the lack of a functional MutT protein results in a mutator phenotype that is a much stronger mutator than if 8-oxoG DNA glycosylase is missing (31). Mice defective in the MTH1 gene have more tumors in the lungs, livers, and stomachs 18 months after birth than wild-type animals. MTH1/ murine cell lines exhibit increased mutation rates compared with wild-type cells (32).
To better understand a role of oxidative DNA damage in lung cancer development, we compared three oxidative DNA damage/repair measures in patients with nonsmall-cell lung cancer (NSCLC): 8-oxoG level in DNA, 8-oxoGexcising (hOGG1), and 8-oxodGTPhydrolyzing (hMTH1) activities in tumor and surrounding normal lung tissue. Our goal was also to determine the relative contributions of these activities to regulating thelevel of 8-oxoG in DNA.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Materials
All chemical reagents were of high purity. Monoclonal anti-
-actin antibody was purchased from Santa Cruz Biotech., Inc. (Santa Cruz, CA). T4 polynucleotide kinase, [
-32P]ATP, Hybond-C membrane, horseradish peroxidaseconjugated goat antirabbit immunoglobulin G (IgG), and the enhanced chemiluminescence (ECL) Western blotting detection reagents were obtained from Amersham-Pharmacia Biotech (Uppsala, Sweden). Micro Bio-Spin P-30 columns were obtained from Bio-Rad Laboratories (Hercules, CA). The 40-base oligodeoxynucleotide containing a single 8-oxoG at position 20 in the sequence 5'-d(GCTACCTACCTAGCGACCTXCGACTGTCCCACTGCTCGAA)-3', in which X indicates 8-oxoG, and the complementary oligodeoxynucleotide, containing C opposite 8-oxoG, were obtained from Eurogentec Herstal (Herstal, Belgium). Yeast 8-oxoG DNA glycosylase (yOGG1) was a kind gift from Dr. Serge Boiteux (CEA, Fontenay-aux-Roses, France).
We prepared 8-oxodGMP according to a published procedure (33), with minor modifications. Tributylammonium phosphate and pyrophosphate were used as phosphorylating agents to generate 8-oxodGDP and 8-oxodGTP, respectively, from an imidazolidate derivative of 8-oxodGMP (34). All reaction mixtures were separated and purified of individual nucleotides by using DEAE-Sephadex A-25 (carbonate form) columns, with appropriate concentration gradients of triethylammonium bicarbonate as eluents. High-performance liquid chromatography (HPLC) was used to assess the purity of the prepared 8-oxo-2'-deoxyguanosine 5'-mono-, di-, and triphosphate before (i.e., in the nucleotide form) and after (i.e., in nucleoside form) complete dephosphorylation by bacterial alkaline phosphatase.
Study Group and Tissue Sampling
The study was performed on a group of 56 patients with primary NSCLC, who underwent pulmonary surgery during the period from February 2001 through January 2003 at the Department and Clinic of Thoracic Surgery and Tumours, Medical University Hospital, in Bydgoszcz, Poland. Patients who had undergone prior chemotherapy or radiation therapy (within 3 weeks before surgery) were excluded from the study. Of the 56 patients, 51 had not received any treatment before surgery. Although it is unclear whether the other five patients had received chemotherapy, they had not received treatment for at least 3 weeks before surgery. Each patient was assigned an individual code number. All patients answered a questionnaire concerning demographic data, smoking, diet, vitamin uptake, and medical history. The questionnaire was administered by the team physician (J. Kowalewski). The patient cohort comprised 41 men and 15 women and 32 smokers and 24 ex-smokers, i.e., individuals who had refrained from smoking for at least 2 years. The mean age was 60 years (range, 4182 years). Information on the type of tumor and treatment of patients was collected by the team physician (J. Kowalewski). The histologic type of cancer was determined according to the World Health Organization classification (35). Thirty-six patients had squamous cell carcinomas (SCCs), and 14 patients had ADCs. For six patients, no information about the type of cancer was obtained. The information about tumor histology and patient questionnaire responses were blinded to all investigators (with the exception of the team physician) until after the statistical analysis was complete.
Samples were obtained from tissues removed during therapeutic surgery. Pairs of samples from the tumor and the surrounding normal tissue were collected from each patient. Each sample was divided into two parts: one part was used to isolate DNA and determine 8-oxoG levels at the Department of Clinical Biochemistry, Medical University, in Bydgoszcz; the other part was used to prepare tissue extracts and determine hOGG1 and hMTH1 protein activities at the Department of Molecular Biology, Institute of Biochemistry and Biophysics, PAS, Warsaw. The samples were immediately frozen under liquid nitrogen and kept at 80 °C during transportation and storage.
The study was conducted in accordance with the Helsinki Declaration, and the protocol was approved by the medical ethics committee of L. Rydygier Medical University, Bydgoszcz, Poland (in accordance with Good Clinical Practice, Warsaw, Poland, 1998). All study participants provided written informed consent.
DNA Isolation and 8-OxoG Determination
DNA from lung tissue was isolated as previously described (36), with some modifications (37). The research team participated in the European Standards Committee on Oxidative DNA Damage (ESCODD), a European Community project that ended in 2003, which was set up to critically examine the different approaches to measure base oxidation in DNA. In several interlaboratory trials determining the levels of 8-oxoG in HeLa cell DNA, isolated from untreated cells or from cells treated with light in the presence of a photosensitizer to induce different amounts of 8-oxoG in DNA, our laboratory demonstrated a low background level of 8-oxoG in DNA from untreated cells and an ability to detect a doseresponse between the concentration of photosensitizer and the level of 8-oxoG in DNA of treated cells (37). Levels of 8-oxoG were determined by the HPLC/electrochemical detection technique, as described previously (38). For technical reasons (enzymatic digestion of DNA to deoxynucleosides and better solubility of the oxidized deoxynucleoside than of the base), 8-oxoG was analyzed as its 2'-deoxynucleoside equivalent, 7,8-dihydro-8-oxo-2'-deoxyguanosine (8-oxo-2'-deoxyguanosine, 8-oxodG). The amount of both molecules in the DNA is exactly the same. The level of 8-oxoG in DNA is reported in number of 8-oxoG per 106 unmodified G.
Preparation of Tissue Extracts
Lung tissue samples were homogenized with four volumes of buffer containing 50 mM Tris-HCl, pH 7.5, 1 mM EDTA, 10 mM dithiothreitol, and 1 mM phenylmethylsulfonyl fluoride. Cells were disrupted by sonication (three times with 15-second pulses and 30-second intervals). Cell debris was removed by centrifugation (7000g, 4 °C, 15 minutes), and the supernatant was collected. Protein concentration in the supernatant was determined by the Bradford method (39) using the Sigma (St. Louis, MO) protein assay reagent. Supernatants were stored in aliquots at 80 °C until tested.
hOGG1 (8-OxoGexcising Activity) Assay
The 5'-end of the 40-base oligodeoxynucleotide containing 8-oxoG at position 20 was labeled with 32P by polynucleotide kinase and an excess of [
-32P]ATP (3000 Ci/mmol). The radiolabeled oligodeoxynucleotide was purified using a Micro Bio-Spin P-30 column, according to the manufacturer's recommended protocol. This oligonucleotide was annealed to its complementary oligonucleotide (present in twofold-molar excess), such that C was opposite 8-oxoG, by incubating the oligonucleotides together at 95 °C for 3 minutes and subsequently cooling the mixture to room temperature for at least 2 hours. Formation of the oligonucleotide duplexes was verified by subjecting the duplexes to nondenaturing polyacrylamide gel electrophoresis (PAGE).
We measured the ability of enzymes in the lung tissue extracts to excise 8-oxoG by determining the extent of nicking of the oligodeoxynucleotide at the site of lesion. The reaction mixture of 20 µL contained 25 mM Tris-HCl, pH 7.8, 50 mM NaCl, 5 mM
-mercaptoethanol, 1 mM EDTA, 1 pmol of 32P-labeled duplex, and increasing amounts of tissue extract (1100 µg of protein/sample). The mixtures were incubated at 37 °C for 1 hour, and the reactions were stopped by digestion with proteinase K (1 µg/µL of reaction mixture, 1 hour, 37 °C). Because the lyase activity of recombinant full-length human OGG1 protein is approximately 5- to 10-fold lower than that of glycosylase (40), we incubated the reaction mixtures in 0.2 M NaOH at 70 °C for an additional 30 minutes. This incubation permitted complete cleavage of the oligonucleotide at the apurinic site formed in the oligodeoxynucleotide molecule after excision of 8-oxoG. The cleavage products were mixed with denaturing gel loading buffer (95% formamide, 20 mM EDTA, 0.05% bromophenol blue, and 0.05% xylene cyanol) and were subjected to 20% PAGE in the presence of 7 M urea. A scheme of the nicking assay and a representative autoradiogram of the excision activities in lung tissues from one patient are shown in Fig. 1, A and B. A digital image of the separated radioactive oligonucleotides was captured on a Molecular Dynamics Storm 820 PhosphorImager, and the radioactivity of the bands was quantified with ImageQuant software (Molecular Dynamics, version 5.2). From each data set, a MichaelisMenten curve was plotted, and the activities of the enzymes were calculated from the initial velocity, i.e., from the part of the curve characterized by the linear increase of the reaction rate. All measurements were performed at least in triplicate, and calculated means are presented as picomoles of cleaved 32P-oligonucleotide (20-bases) per hour per milligram of protein. Each experiment included positive and negative control samples. The positive control consisted of the 32P-labeled oligonucleotide being digested with an excess of the damage-specific repair glycosylase/AP-lyase yOGG1, and the negative control consisted of omitting the lung tissue supernatant from the reaction mixture with 32P-labeled oligonucleotide.
|
Protein extraction efficiency and protein integrity were assessed by Western blot analysis of
-actin levels in extracts of normal and tumor lung tissues. Equal amounts of protein extracts (50 µg/lane) were resolved on sodium dodecyl sulfate10% polyacrylamide gels and were electrotransferred to Hybond-C membranes. The membranes were blocked for 2 hours at room temperature in a blocking solution containing 5% nonfat dry milk, 1% bovine serum albumin, and 0.05% Tween 20 in phosphate-buffered saline, and incubated sequentially with a monoclonal anti
-actin antibody (1 µg/mL, diluted in blocking solution) for 2 hours at room temperature and horseradish peroxidaseconjugated secondary antibody. The proteinantibody bands were visualized after the membranes were incubated with the ECL reagent, according to the manufacturer's recommendations. hMTH1 (8-OxodGTPase) Assay
Lung tissue extracts were treated according to a previously published protocol (33), with minor modifications. Extracts (0.5 mL) were subjected to ultracentrifugation (1 hour at 100 000g, 4 °C), and the supernatants were collected. The supernatant protein concentrations were estimated (39), and Triton X-100 was added to each sample to a final concentration of 0.1%. Next, the supernatants were filtered through a low protein-binding ultrafiltration membrane, which had a 30-kD protein cutoff (Ultrafree-MC Filtration Unit; Millipore). The ultrafiltration procedure removes nonspecific phosphatases (i.e., those with a molecular mass greater than 30 kD), the presence of which interferes with determining 8-oxodGTPase (molecular mass, 18 kD) activity (33). We found (unpublished data) that the addition of Triton X-100 improves the ultrafiltration and recovery of 8-oxodGTPase. 8-OxodGTPase activity was measured immediately in the resulting flow-through fraction, i.e., ultrafiltrate, or after being temporarily stored at 80 °C.
8-OxodGTPase activity in the ultrafiltrates was determined by measuring the degradation of 8-oxodGTP to 8-oxodGMP according to a previously published protocol (19). The reaction mixture (total volume of 100 µL) contained 40 µM 8-oxodGTP, 5 mM MgCl2, 40 mM NaCl, and 50 mM Tris-HCl, pH 8. The mixture was incubated for 2 minutes, after which the reaction was started by the addition of the ultrafiltrate (0.5 to 1000 µg of protein). Samples were incubated for 1 hour at 37 °C, and the reaction was stopped by the addition of 10 µL of 100 mM EDTA.
Because the 8-oxodGTPase activity in tissue extracts varied up to 50-fold among patients, the preliminary experiments determined the amount of extract needed to yield the product of hydrolysis of 8-oxodGTP within the range of 3%60%. Each ultrafiltrate was then finally tested at four concentrations, with the concentrations of protein chosen on the basis of initial experiments. Subsequently, samples (100 µL) were subjected to HPLC analysis. Chromatographic conditions were as follows: Waters High Performance Carbohydrate Column, 60 Å, 4 µm, 4.6 x 250 mm; isocratic elution with 0.2 M phosphate buffer, pH 4, 1 mM EDTA; flow rate, 1 mL/min; UV detection at 295 nm (see Fig. 2 for examples of HPLC profiles). Products were quantified by using Millennium software (version 2.15). The amount of 8-oxodGMP formed during the reaction was estimated as a percentage of the sum of 8-oxodGMP and 8-oxodGTP (determined from the HPLC peaks) and calculated in nanomoles of 8-oxodGMP formed per hour per milligram of protein. From each data set, a MichaelisMenten curve was plotted, and enzymatic activities were calculated from initial velocities. All measurements were performed using at least two independent ultrafiltrates of the same tissue extract, and calculated means are presented. To measure possible spontaneous degradation of 8-oxodGTP, each series of experiments included a sample in which the reaction mixture did not include the ultrafiltrate and a sample where EDTA was added before addition of the ultrafiltrate.
|
Statistical Analysis
All variables were examined for normality and homogeneity of variance. To use parametric statistical tests in the analysis of variance, variables that were not normally distributed (i.e., for the whole patient population) were normalized via transformation to natural logarithms. Data are presented as means and standard deviations or as the antilog of the means (geometric means) and the 95% confidence interval (CI) of the antilog of the means. The levels of 8-oxoG were measured once. The cohort of patients fell into two subpopulations: one with similar 8-oxoG levels both in normal lung and lung tumor (subgroup I, n = 37), and the other with approximately twofold-higher 8-oxoG levels in normal lung than in lung tumor (subgroup II, n = 10) (Table 1, Fig. 3, A). For hOGG1 and hMTH1 activities, the results present the mean values of three and two measurements, respectively. In the graph showing the relation between hMTH1 activities in normal lung and lung tumor tissues, three apparent clusters of points can be distinguished (Fig. 3, C). Therefore, three subpopulations were discriminated analytically on the basis of means from normal lung to tumor ratios. By visual inspection of the means, the first population (mean ratio = 1.44) consisted of four patients who had apparently higher hMTH1 activity (>20 nmol h1 mg1 protein) in normal lung than did the remaining patients; we considered the four patients outliers and excluded them from further analyses. The other subpopulations were subgroup III (n = 16, mean ratio = 0.16) and subgroup IV (n = 13, mean ratio = 0.61) (Table 1, Fig. 3, C). Differences in the level of 8-oxoG between normal lung and lung tumor tissues were tested for statistical significance using Student's t test for dependent samples. Differences in hOGG1 and in hMTH1 activities were analyzed with one-way repeated analyses of variance (ANOVAs), with the repeated measures of hOGG1 and hMTH1 activities as within-subject factors. To determine whether smoking, histologic type of tumor, and/or sex was associated with the level of 8-oxoG and enzyme activities in normal lung and in tumor, data were analyzed with one-way ANOVAs (for the 8-oxoG level) or with one-way repeated ANOVAs (with repeated measures of hOGG1 and hMTH1 activities as within-subject factors). Additionally, to investigate the cooperative association of smoking, histologic type of tumor, and sex (as the main, nested, or between-subject factors), three-way main effect ANOVAs for 8-oxoG level and means of replicates of hOGG1 and hMTH1 activity measurements, which had not revealed any significant effect of within-subject factors on differences between these variables in the ANOVA, were conducted. Interactions were further examined by Tukey's honestly significant difference (HSD) test. Associations between different variables within the whole patient population were calculated by Spearman's correlation analysis. Pearson's correlation was calculated within each subgroup of patients. All statistical analyses were performed using STATISTICA 6.0 (StatSoft, Inc., Tulsa, OK). All statistical tests were two-sided, and P values less than 0.05 were considered statistically significant.
|
|
| RESULTS |
|---|
|
|
|---|
8-OxoG Level in DNA
The levels of 8-oxoG were measured in normal lung and tumor DNA samples from 47 of the 56 patients (the amount of DNA isolated from nine other samples was insufficient to perform the analyses). The levels of 8-oxoG were highly variable in both tissue types, ranging from 2.44 to 34.23 8-oxoG per 106 G in normal lung tissue DNA and from 1.44 to 13.13 8-oxoG per 106 G in lung tumor DNA. Overall, the 8-oxoG levels were higher in normal lung DNA than in lung tumor DNA (Table 1).
We assumed that the level of 8-oxoG in DNA was intrinsic to the individual, probably reflecting the level of oxidative stress to which a person had been exposed and individual repair capacity. Accordingly, we observed a positive correlation between 8-oxoG levels in DNA from paired normal and tumor lung tissues (
= 0.61, P <. 001, n = 47). The cohort of patients fell into two distinct subpopulations: subgroup I (n = 37), with similar mean 8-oxoG levels in both the normal lung and tumor tissue, and subgroup II (n = 10), with approximately twofold-higher levels in normal lung than in tumor tissue. Subgroup I had mean levels of 8.85 (standard deviation = 3.30) and 6.08 (standard deviation =2.88) 8-oxoG per 106 G in normal lung and tumor tissues, respectively; and subgroup II (n = 10) had mean levels of 23.86 (standard deviation = 6.05) and 7.87 (standard deviation = 2.12) 8-oxoG per 106 G for normal lung and tumor tissues, respectively (Table 1). We found a positive correlation between normal lung tissue and tumor tissue in 8-oxoG levels for patients in both subgroups (for subgroup I, r = 0.63, P<.001; for subgroup II, r = 0.46, P = .177 [Fig. 3, A]), although, given the small number of patients in subgroup II, the correlation was not statistically significant.
hOGG1 (8-OxoGExcising) Activity
We next measured the hOGG1 activities by the nicking assay in tissues from all 56 patients. The level of hOGG1 activity was highly variable among patient tissues, ranging from 3.54 to 62.91 pmol h1 mg1 protein in normal lung tissue and from 2.35 to 34.85 pmol h1 mg1 protein in lung tumor tissue. hOGG1 activity was higher in normal lung than in tumor tissue (Table 1).
To determine whether the differences in hOGG1 activities among normal lung and tumor tissues were the result of a differential of enzyme protein enrichment, we performed two control experiments: Western blot analysis for
-actin using aliquots of tissue extracts (Fig. 1, C) and determination of hOGG1 activity in at least three independent protein extractions from each tissue sample. We observed comparable levels of
-actin in 50 µg of protein extract from tumor and normal tissues and comparable hOGG1 activities in distinct protein extracts from the same tissue samples, suggesting that differential protein enrichment did not account for the differences in hOGG1 activities.
The activities of hOGG1 in normal and tumor lung tissue were positively correlated (
= 0.4, P = .002, n = 56; Fig. 3, B). However, there was no correlation between the 8-oxoG level and 8-oxoGexcising activity in normal lung or tumor tissues.
hMTH1 (8-OxodGTPase) Activity
hMTH1 activities were measured in tissue extract ultrafiltrates from 33 of the 56 patients using HPLC. Because the hMTH1 assay requires a large amount of tissue extract and the hMTH1 activity measurements were done after hOGG1 activity assays, the amounts of tissue extracts of the remaining 23 patients were insufficient to perform analyses. Typical HPLC separations of the 8-oxodGTP substrate and the 8-oxodGMP reaction product formed during incubation with a tissue extract ultrafiltrate from a patient are shown in Fig. 2. The hMTH1 activities were highly variable among patients, ranging from 3.2 to 27.2 nmol h1 mg1 protein in normal lung tissue and from 2.7 to 144.9 nmol h1mg1 protein in lung tumor tissue. Overall, hMTH1 activities were higher in tumor tissues than in normal lung tissues (Table 1); however, no correlation of hMTH1 activity in the paired normal lung and tumor tissues in the whole patient population (n = 33) was found. Although higher hMTH1 activity coincided with the lower level of 8-oxoG, levels of hMTH1 activity did not correlate with 8-oxoG levels or with hOGG1 activity in either normal lung or tumor tissues.
In the patient cohort, two subpopulations (subgroups III and IV) and a group of four outliers could be distinguished by visual inspection (see Materials and Methods). Although a correlation was found for hMTH1 activity in the paired normal lung and tumor tissues among the outlier group (r = 0.8, P = .203, n = 4), this group was excluded from further analysis because of the high P value and the small number of patients. For the remaining 29 patients, hMTH1 activity in normal and tumor lung tissues was positively correlated (
= 0.55, P = .003, n = 29). Moreover, after excluding the outliers, we found strong correlations in the two apparent subpopulations within the cohort: for subgroup III (n = 16), r = 0.84, P<.001; and for subgroup IV (n = 13), r = 0.83, P<.001 (Fig. 3, C, Table 1). For the entire cohort (n = 33), the cohort after excluding the four outliers (n = 29), and subgroups III and IV, there was no inverse correlation between the hMTH1 activities and 8-oxoG levels, either in normal lung or in tumor DNA, as would have been expected if hMTH1 was the only enzyme responsible for maintenance of 8-oxoG level in DNA.
Associations Among Tobacco Smoking, Histologic Type of Tumor, and Sex and 8-OxoG levels, and hOGG1 or hMTH1 Activities
We next examined the associations among smoking status (current versus former smoker), tumor histology (SCC versus ADC), and patient sex and 8-oxoG levels, and hOGG1 or hMTH1 activities. There was no association of smoking status with the 8-oxoG level, hOGG1 activity, or hMTH1 activity in normal lung and tumor tissues, regardless of whether we considered all patients together or in the apparent subgroups (Table 2).
|
No statistically significant differences in 8-oxoG levels or in hMTH1 activities were observed between patients grouped according to histologic type of tumor (Table 2). By contrast, hOGG1 activity was higher in normal lung tissue of patients with ADCs than in patients with SCCs (P = .047; Table 2).
Men and women did not differ statistically significantly in normal lung and tumor tissue in 8-oxoG levels and hOGG1 or hMTH1 activities (Table 2). The only sex-related difference was found in subgroup I, in which men had higher 8-oxoG levels in normal lung tissue than did women (P = .027; Table 2).
To identify interactions among sex, smoking, and histologic type of tumor, the data were examined using three-way ANOVAs, with nested between-group factors. Potential interactions found were further analyzed with Tukey's HSD test. The only statistically significant interaction was between tumor histology and sex (P = .033; Table 2). hOGG1 activity in normal lung was higher in women with ADCs, although the relationship was not statistically significant (P = .056, Tukey's HSD test).
| DISCUSSION |
|---|
|
|
|---|
The link between smoking tobacco and lung cancer is generally acknowledged. Because tobacco smoke induces oxidative DNA damage, we sought to learn whether the level of 8-oxoG, a general marker of oxidative damage to DNA, is associated with lung cancer. In addition, we studied the role of two repair enzymes, hOGG1 (8-oxoG DNA glycosylase) and hMTH1 (8-oxodGTPase), in the maintenance of 8-oxoG levels in DNA of lung cancer patients.
Our most striking finding was that the level of 8-oxoG in DNA from lung tumor tissue was lower than that in DNA from normal lung tissue, even though hOGG1 activity was also lower in lung tumor tissue than in normal lung tissue (Table 1). These observations are paradoxical because one would expect to find low levels of 8-oxoG in tissues with high hOGG1 activity. These observations were also surprising because, in our previous study on repair of lipid peroxidation-generated DNA etheno adducts in the lungs of NSCLC patients (28), the levels of these adducts were similar in tumor and normal tissues, whereas the excising activities were higher in tumor tissues than in normal lung tissues, possibly to counter the increased DNA damage associated with oxidative stress and lipid peroxidation in tumor tissues. However, etheno adducts are excised by glycosylases entirely different from those involved in the excision of 8-oxoG, and the activity of different repair enzymes can be modified differently by oxidative stresstriggered factors. Indeed, we found that hMTH1 protein activity, which catalyzes the hydrolysis of 8-oxodGTP to 8-oxodGMP, a step that limits the incorporation of 8-oxoG into DNA (18,19), was statistically significantly higher in tumor than in normal tissue (Table 1). The results of determinations of the 8-oxoG levels and both enzymatic activities, i.e., hOGG1 and hMTH1, suggest that incorporation of 8-oxodGTP into DNA from the nucleotide pool may be an important source of 8-oxoG in DNA. Thus, the high hMTH1 activity might have compensated for the low hOGG1 activity, resulting in a lower 8-oxoG level in tumor DNA.
The potential biologic relevance of the removal of 8-oxodGTP from the cellular pool for the level of 8-oxoG in DNA is further highlighted because the hMTH1 activity observed in human lung tissues was three orders of magnitude higher than the hOGG1 activity excising 8-oxoG from DNA. In other words, the hydrolysis of 8-oxodGTP was expressed in nanomoles per hour per milligram of protein, whereas the excision of 8-oxoG from DNA was expressed in picomoles per hour per milligram of protein (Table 1). This difference in activities can be attributed mostly to the differences in the turnover of these enzymes. The kcat values are 211 min1 for hMTH1 (K. D. Arczewska, unpublished) and 0.1 min1 for hOGG1 (41).
Given our results, if hMTH1 activity is more critical than is hOGG1 activity for the level of 8-oxoG in DNA, then the incorporation of damaged precursors from the nucleotide pool may be more harmful for genomic DNA integrity than the damaging of the DNA itself. However, experimental data with living cells to support such a hypothesis are sparse. Unincorporated bases in the dNTP pool are much more susceptible to methylation than are incorporated bases in DNA from C3H mouse embryo fibroblasts treated with the methylating agent N-methyl-N-nitrosourea (42). The susceptibility to methylation depended on the modified position; e.g., N7 of G was methylated 190-fold and N1 of A 13 000-fold more efficiently as free nucleotides than as incorporated bases in DNA. These data corroborate the notion that free nucleotide bases should be much more reactive than are incorporated bases in cellular DNA, where they are protected by the double helix and chromosomal structures.
Although the mechanism for increased hMTH1 activity in tumor tissue versus normal tissue is unknown, one possibility is an increase in hMTH1 mRNA levels. In several types of cancers (4347), including brain (46) and lung (47), hMTH1 mRNA levels are increased relative to levels in normal cells. Whether the increased hMTH1 mRNA levels in tumors reflect a response to increased oxidative stress is unclear. However, hydrogen peroxide, a chemical inducer of oxidative damage, increased hMTH1 mRNA expression and enzyme activity two- to threefold in human lymphoid cells and normal fibroblasts (48), and exposure of human alveolar epithelial cells to crocidolite asbestos increased hOGG1 and hMTH1 mRNA expression and 8-oxoGexcising activity (49).
The observed increase in hMTH1 activity in lung tumor tissue may suggest that a substantial fraction of 8-oxoG in human DNA is derived from the oxidized nucleotide pool. A similar conclusion has been drawn from several in vitro studies. First, Russo et al. (50) observed that overexpression of the hMTH1 protein in mismatch repairdeficient cell lines decreased the mutation rates to normal, reduced microsatellite instability, and led to reduced 8-oxoG levels in DNA. Second, expression levels of hMTH1 mRNA were inversely proportional to the levels of 8-oxoG in DNA in 11 human lung cancer cell lines and simian virus 40transformed nontumorigenic human bronchial epithelial cells (45). Third, hydrogen peroxideinduced accumulation of 8-oxoG in nuclear and mitochondrial DNA in MTH1-null mouse fibroblasts was suppressed by expression of human MTH1 in these cells (51). Fourth, MTH1 activity was higher and background levels of 8-oxoG were lower in fetal DNA than the levels found in maternal mouse organs (52). In our study, although we noted concomitantly increased hMTH1 activity and decreased 8-oxoG levels in DNA from tumor tissues (Table 1), the correlation between these parameters was not statistically significant. This lack of correlation may suggest that, although hMTH1 is an important component in regulating the 8-oxoG level in human lung DNA, other DNA repair pathways and antioxidant defense mechanisms may also be involved.
Although the exact mechanism for decrease in hOGG1 activity in tumor lung tissue relative to normal lung tissue is unknown, several potential mechanisms may explain it. The first is loss of heterozygosity (LOH) at the hOGG1 locus. LOH at the OGG1 results in decreased expression of the OGG1 gene and was observed in 62.2% of patients with SCLCs and NSCLCs (53) and in up to 38% of head-and-neck squamous cancer patients, as measured by single nucleotide polymorphism characterizing hOGG1 allelic loss and by immunohistochemical staining (54). However, not all studies find a high level of OGG1 allelic loss (55). Although in our study, LOH at OGG1 locus was not examined, it is unlikely to be the only reason for the decrease in enzymatic activity. The rate of 8-oxoG excision was decreased in 52 (92.9%) of 56 examined tumors relative to unaffected surrounding lung tissue, and the extent of this decrease (2- to 10-fold in 37 of 56 tumors) was much higher than would be expected for decreases associated with LOH at OGG1 locus. The second is tumor-associated (i.e., somatic) mutations in the hOGG1 gene resulting in lost functional activity. Although tumor-associated mutations in the hOGG1 gene have been reported (55), the frequency of them was low in human kidney cancers (only 4%) and even lower in lung cancers, suggesting that such mutations in the hOGG1 gene are an unlikely explanation for our observation. The third is deregulation of OGG1 cooperation with partners of the BER pathway. One partner is the human apurinic site endonuclease 1 (HAP1), which cleaves DNA at apurinic sites and stimulates OGG1 activity in vitro up to 400-fold by increasing OGG1 turnover on damaged DNA (41). However, in our assay, in which we used 0.2 M NaOH for complete cleavage of oligodeoxynucleotide, it was not possible to assess the influence of HAP1 levels on OGG1 activity. Expression of HAP1 is increased in many tumors (56), and because HAP1 is induced in the S phase of the cell cycle (57), it is likely that its level is increased in highly proliferating tissues. HAP1 is induced by hydrogen peroxide (58), which could mimic endogenous oxidative stress in tumors. Therefore, it is unlikely that the observed decreased OGG1 activity in lung tumor tissues in our experiments is caused by decreased expression of HAP1 protein. However, we cannot exclude deregulation of the interaction between hOGG1 and its other partner, XRCC1 protein (X-ray cross-complementation group protein 1), which coordinates and stimulates hOGG1 activity (59). A fourth possible mechanism is inhibition of OGG1 activity by modification of OGG1 protein. Exogenous nitric oxide and peroxynitrite have been shown to inhibit the activity of hOGG1 (60), as well as that of other enzymes involved in DNA repair (6163), by direct nitrosylation. Despite the contradictory data regarding the activity of nitric oxide synthase in various types of lung cancer versus normal lung tissues (64,65), the inactivation of hOGG1 protein by reactive nitrogen species in tumors is a plausible explanation of the decreased hOGG1 activity in lung cancer tissues. Although hOGG1 can also undergo phosphorylation, phosphorylation seems to alter the enzyme localization rather than activity (66), suggesting that this fifth possible mechanism is an unlikely explanation for our observation.
Different etiologies are believed to be responsible for the different histologic types of NSCLC. ADC has been linked to defective repair of 8-oxoG because of a hOGG1 gene polymorphism (67) and to decreased hMTH1 expression relative to hMTH1 expression in SCC types of NSCLC (47). In our study, although we also observed lower hMTH1 activity in normal lung tissue from the four patients with ADCs than from the 29 patients with SCCs, the relationship was not statistically significant (Table 2). We did not observe statistically significant differences in 8-oxoG levels in normal lung tissue DNA from patients grouped according to tumor histology (Table 2). We did, however, observe that hOGG1 activity was higher in normal lung tissue from patients with ADCs than in patients with SCCs (P = .047; Table 2). One possible explanation for this difference is related to the detection of several different polymorphisms in the OGG1 gene (68): the most common polymorphism is a Ser326Cys polymorphism (69), and at least one polymorphism, the Cys/Cys variant at amino acid 326, is associated with lower OGG1 activity (53) and the risk of development of lung SCC (70,71). Whether the frequency of the Cys/Cys polymorphism was higher in our patients with SCC than in those with ADC is unknown.
In summary, we found that the 8-oxoG level and the excising activity were statistically significantly lower in tumor lung tissue than in the surrounding normal lung tissue. By contrast, hMTH1 activity was statistically significantly higher in tumor tissue than in normal lung tissue. These data suggest that incorporation of 8-oxoG from the nucleotide pool is an important mechanism in the formation of DNA oxidative damage in humans. The results also raise an important question concerning the mechanisms that regulate hOGG1 activity in association with oxidative stress and neoplastic transformation.
| NOTES |
|---|
|
|
|---|
E. Speina, K. D. Arczewska, and D. Gackowski contributed equally to the work. This work was supported by a grant from the State Committee for Scientific Research (PBZ-KBN-091/P05/2003/55) and was conducted within the activity of the Center of Excellence in Molecular Biotechnology, Institute of Biochemistry and Biophysics PAS (WP10). D. Gackowski and R. Oli
ski also acknowledge the Foundation for Polish Science for support. | REFERENCES |
|---|
|
|
|---|
(1) Floyd RA. The role of 8-hydroxyguanine in carcinogenesis. Carcinogenesis 1990;11:144750.
(2) Olinski R, Gackowski D, Foksinski M, Rozalski R, Roszkowski K, Jaruga P. Oxidative DNA damage: assessment of the role in carcinogenesis, atherosclerosis, and acquired immunodeficiency syndrome. Free Radic Biol Med 2002;33:192200.[CrossRef][Web of Science][Medline]
(3) Olinski R, Gackowski D, Rozalski R, Foksinski M, Bialkowski K. Oxidative DNA damage in cancer patients: a cause or a consequence of the disease development? Mutat Res 2003;531:17790.[Web of Science][Medline]
(4) Dizdaroglu M. Oxidative damage to DNA in mammalian chromatin. Mutat Res 1992;275:33142.[CrossRef][Web of Science][Medline]
(5) Helbock HJ, Beckman KB, Ames BN. 8-Hydroxydeoxyguanosine and 8-hydroxyguanine as biomarkers of oxidative DNA damage. Methods Enzymol 1999;300:15666.[CrossRef][Web of Science][Medline]
(6) Shibutani S, Takeshita M, Grollman AP. Insertion of specific bases during DNA synthesis past the oxidation-damaged base 8-oxodG. Nature 1991;349:4314.[CrossRef][Medline]
(7) Maki H, Sekiguchi M. MutT protein specifically hydrolyses a potent mutagenic substrate for DNA synthesis. Nature 1992;355:2735.[CrossRef][Medline]
(8) Michaels ML, Miller JH. The GO system protects organisms from the mutagenic effect of the spontaneous lesion 8-hydroxyguanine (7,8-dihydro-8-oxoguanine). J Bacteriol 1992;174:63215.
(9) Hazra TK, Izumi T, Venkatarman R, Kow YW, Dizdaroglu M, Mitra S. Characterization of a novel 8-oxoguanine-DNA glycosylase activity in Escherichia coli and identification of the enzyme as endonuclease VIII. J Biol Chem 2000;275:277627.
(10) Radicella JP, Dherin C, Desmaze C, Fox MS, Boiteux S. Cloning and characterization of hOGG1, a human homolog of the OGG1 gene of Sacharomyces cerevisiae. Proc Natl Acad Sci U S A 1997;94:80105.
(11) Hazra TK, Izumi T, Maidt L, Floyd RA, Mitra S. The presence of two distinct 8-oxoguanine repair enzymes in human cells: their potential complementary roles in preventing mutation. Nucleic Acids Res 1998;26:511622.
(12) Hazra TK, Hill JW, Izumi T, Mitra S. Multiple DNA glycosylases for repair of 8-oxoguanine and their potential in vivo functions. Prog Nucleic Acid Res Mol Biol 2001;68:193205.[Web of Science][Medline]
(13) Hazra TK, Izumi T, Boldogh I, Imhoff B, Kow YW, Jaruga P, et al. Identification and characterization of a human DNA glycosylase for repair of modified bases in oxidatively damaged DNA. Proc Natl Acad Sci U S A 2002;99:35238.
(14) Dou H, Mitra S, Hazra TK. Repair of oxidized bases in DNA bubble structures by human DNA glycosylases NEIL1 and NEIL2. J Biol Chem 2003;278:4967884.
(15) Yeh YC, Chang DY, Masin J, Lu AL. Two nicking enzyme systems specific for mismatch-containing DNA in nuclear extracts from human cells. J Biol Chem 1991;266:64804.
(16) McGoldrick JP, Yeh YC, Solomon M, Essigman JM, Lu AL. Characterization of a mammalian homolog of the Escherichia coli MutY mismatch repair protein. Mol Cell Biol 1995;15:98996.[Abstract]
(17) Slupska MM, Baikalov C, Luther WM, Chiang JH, Wei YF, Miller JH. Cloning and sequencing a human homolog (hMYH) of the Escherichia coli mutY gene whose function is required for the repair of oxidative DNA damage. J Bacteriol 1996;178:388592.
(18) Mo JY, Maki H, Sekiguchi M. Hydrolytic elimination of a mutagenic nucleotide, 8-oxodGTP, by human 18-kilodalton protein: sanitization of nucleotide pool. Proc Natl Acad Sci U S A 1992;89:110215.
(19) Sakumi K, Furuichi M, Tsuzuki T, Kakuma T, Kawabata S, Maki H, et al. Cloning and expression of cDNA for a human enzyme that hydrolyzes 8-oxo-dGTP, a mutagenic substrate for DNA synthesis. J Biol Chem 1993;268:2352430.
(20) Fujikawa K, Kamiya H, Yakushiji H, Fuji Y, Nakabeppu Y, Kasai H. The oxidized forms of dATP are substrates for the human MutT homolgue, the hMTH1 protein. J Biol Chem 1999;274:182015.
(21) Fujikawa K, Yakushiji H, Nakabeppu Y, Suzuki T, Masuda M, Ohshima H, etal. 8-Chloro-dGTP, a hypochlorous acid-modified nucleotide, is hydrolyzed by hMTH1, the human MutT homolog. FEBS Lett 2002;512:14951.[CrossRef][Web of Science][Medline]
(22) Slupphaug G, Kavli B, Krokan HE. The interacting pathways for prevention and repair of oxidative DNA damage. Mutat Res 2003;531:23151.[Web of Science][Medline]
(23) Wiencke JK. DNA adduct burden and tobacco carcinogenesis. Oncogene 1998;21:737691.
(24) Asami S, Manabe H, Miyake J, Tsurudome Y, Hirano T, Yamaguchi R, et al. Cigarette smoking induces an increase in oxidative DNA damage, 8-hydroxydeoxyguanosine, in a central site of the human lung. Carcinogenesis 1997;18:17636.
(25) Saetta M. Airway inflammation in chronic obstructive pulmonary disease. Am J Respir Crit Care Med 1999;160:1720.
(26) Gackowski D, Speina E, Zielinska M, Kowalewski J, Rozalski R, Siomek A, et al. Products of oxidative DNA damage and repair as possible biomarkers of susceptibility to lung cancer. Cancer Res 2003;63:4899902.
(27) Paz-Elizur T, Krupsky M, Blumenstein S, Elinger D, Schechtman E, Livneh Z. DNA repair activity for oxidative damage and risk of lung cancer. J Natl Cancer Inst 2003;95:13129.
(28) Speina E, Zielinska M, Barbin A, Gackowski D, Kowalewski J, Graziewicz MA, et al. Decreased repair activities of 1,N6-ethenoadenine and 3,N4-ethenocytosine in lung adenocarcinoma patients. Cancer Res 2003;63:43517. Erratum in: Cancer Res 2003;63:6103.
(29) Klungland A, Rosewell I, Hollenbach S, Larsen E, Daly G, Epe B, et al. Accumulation of premutagenic DNA lesions in mice defective in removal of oxidative base damage. Proc Natl Acad Sci U S A 1999;96:133005.
(30) Minowa O, Arai T, Hirano M, Monden Y, Nakai S, Fukuda M, et al. Mmh/Ogg1 gene inactivation results in accumulation of 8-hydroxyguanine in mice. Proc Natl Acad Sci U S A 2000;97:415661.
(31) Fowler RG, White SJ, Koyama C, Moore SC, Dunn RL, Schaaper RM. Interactions among Escherichia coli mutT, mutM, and mutY damage prevention pathways. DNA Repair 2003;2:15973.[CrossRef][Medline]
(32) Tsuzuki T, Egashira A, Igarashi H, Iwakuma T, NakatsuruY, Tominaga Y, et al. Spontaneous tumorigenesis in mice defective in the MTH1 gene encoding 8-oxo-dGTPase. Proc Natl Acad Sci U S A 2001;98:1145661.
(33) Bialkowski K, Kasprzak, KS. A novel assay of 8-oxo-2'-deoxyguanosine 5'-triphosphate pyrophosphohydrolase (8-oxo-dGTPase) activity in cultured cells and its use for evaluation of cadmium(II) inhibition of this activity. Nucleic Acids Res 1998;26:3193201.
(34) Hoard DE, Ott DG. Conversion of mono- and oligodeoxyribonucleotides to 5'-triphosphates. J Am Chem Soc 1965;87:17858.[CrossRef][Web of Science][Medline]
(35) World Health Organization. Histological typing of lung tumors. Am J Clin Pathol 1982;77:12336.[Web of Science][Medline]
(36) Gackowski D, Kruszewski M, Bartlomiejczyk T, Jawien A, Ciecierski M, Olinski R. The level of 8-oxo-7,8-dihydro-2'-deoxyguanosine is positively correlated with the size of the labile iron pool in human lymphocytes. J Biol Inorg Chem 2002;7:54850.[CrossRef][Web of Science][Medline]
(37) ESCODD. Measurement of DNA oxidation in human cells by chromatographic and enzymic methods. Free Radic Biol Med 2003;34:108999.[CrossRef][Web of Science][Medline]
(38) Foksinski M, Bialkowski K, Skiba M, Ponikowska I, Szmurlo W, Olinski R. Evaluation of 8-oxodeoxyguanosine, typical oxidative DNA damage, in lymphocytes of ozone-treated arteriosclerotic patients. Mutat Res 1999;438:237.[Web of Science][Medline]
(39) Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 1976;72:24855.[CrossRef][Web of Science][Medline]
(40) Roldan-Arjona T, Wei YF, Carter KC, Klungland A, Anselmino C, Wang RP, et al. Molecular cloning and functional expression of a human cDNA encoding the antimutator enzyme 8-hydroxyguanine-DNA glycosylase. Proc Natl Acad Sci U S A 1997;94:801620.
(41) Hill JW, Hazra TK, Izumi T, Mitra S. Stimulation of human 8-oxoguanine-DNA glycosylase by AP-endonuclease: potential coordination of the initial steps in base excision repair. Nucleic Acids Res 2001;29:4308.
(42) Topal MD, Baker MS. DNA precursor pool: a significant target for N-methyl-N-nitrosourea in C3H/10T1/2 clone 8 cells. Proc Natl Acad Sci U S A 1982;79:22115.
(43) Okamoto K, Toyokuni S, Kim WJ, Ogawa O, Kakehi Y, Arao S, et al. Overexpression of human mutT homologue gene messenger RNA in renal-cell carcinoma: evidence of persistent oxidative stress in cancer. Int J Cancer 1996;65:43741.[CrossRef][Web of Science][Medline]
(44) Wani G, Milo GE, D'Ambrosio SM. Enhanced expression of the 8-oxo-7, 8-dihydrodeoxyguanosine triphosphatase gene in human breast tumor cells. Cancer Lett 1998;125:12330.[CrossRef][Web of Science][Medline]
(45) Kennedy CH, Cueto R, Belinsky SA, Lechner JF, Pryor WA. Overexpression of hMTH1 mRNA: a molecular marker of oxidative stress in lung cancer cells. FEBS Lett 1998;429:1720.[CrossRef][Web of Science][Medline]
(46) Iida T, Furuta A, Kawashima M, Nishida J, Nakabeppu Y, Iwaki T. Accumulation of 8-oxo-2'-deoxyguanosine and increased expression of hMTH1 protein in brain tumors. Neuro-Oncology 2001;3:7381.[Abstract]
(47) Kennedy CH, Pass HI, Mitchell JB. Expression of human MutT homologue (hMTH1) protein in primary nonsmall-cell lung carcinomas and histologically normal surrounding tissue. Free Radic Biol Med 2003;34:144757.[CrossRef][Web of Science][Medline]
(48) Meyer F, Fiala E, Westendorf J. Induction of 8-oxo-dGTPase activity in human lymphoid cells and normal fibroblasts by oxidative stress. Toxicology 2000;146:8392.[CrossRef][Web of Science][Medline]
(49) Kim HN, Morimoto Y, Tsuda T, Ootsuyama Y, Hirohashi M, Hirano T, etal. Changes in DNA 8-hydroxyguanine levels, 8-hydroxyguanine repair activity, and hOGG1 and hMTH1 mRNA expression in human lung alveolar epithelial cells induced by crocidolite asbestos. Carcinogenesis 2001;22:2659.
(50) Russo MT, Blasi MF, Chiera F, Fortini P, Degan P, Macpherson P, et al. The oxidized deoxynucleoside triphosphate pool is a significant contributor to genetic instability in mismatch repair-deficient cells. Mol Cell Biol 2004;24:46574.
(51) Yoshimura D, Sakumi K, Ohno M, Saki Y, Furuichi M, Iwai S, et al. An oxidized purine nucleoside triphosphatase, MTH1, suppresses cell death caused by oxidative stress. J Biol Chem 2003;278:3796573.
(52) Bialkowski K, Bialkowska A, Anderson LM, Kasprzak KS. Higher activity of 8-oxo-2'-deoxyguanosine 5'-triphosphate pyrophosphohydrolase (8-oxo-dGTPase) coincides with lower background levels of 8-oxo-2'-deoxyguanosine in DNA of fetal compared with maternal mouse organs. Free Radic Biol Med 1999;27:904.[CrossRef][Web of Science][Medline]
(53) Kohno T, Shinmura K, Tosaka M, Tani M, Kim SR, Sugimura H, et al. Genetic polymorphism and alternative splicing of hOGG1 gene, that is involved in the repair of 8-hydroxyguanine in damaged DNA. Oncogene 1998;16:321925.[CrossRef][Web of Science][Medline]
(54) Fan CY, Liu KL, Huang HY, Barnes EL, Swalsky PA, Bakker A, et al. Frequent allelic imbalance and loss of protein expression of the DNA repair gene hOGG1 in head and neck squamous cell carcinoma. Lab Invest 2001;81:142938.[Web of Science][Medline]
(55) Chevillard S, Radicella JP, Levalois C, Lebeau J, Poupon MF, Oudard S, et al. Mutations in OGG1, a gene involved in the repair of oxidative DNA damage, are found in human lung and kidney tumours. Oncogene 1998;16:30836.[CrossRef][Web of Science][Medline]
(56) Fritz G, Grosch S, Tomicic M, Kaina B. APE/Ref-1 and the mammalian response to genotoxic stress. Toxicology 2003;193:6778.[CrossRef][Web of Science][Medline]
(57) Bouziane M, Miao F, Bates SE, Somsouk L, Sang BC, Denissenko M, etal. Promoter structure and cell cycle dependent expression of the human methylpurine-DNA glycosylase gene. Mutat Res 2000;461:1529.[Web of Science][Medline]
(58) Ramana CV, Boldogh I, Izumi T, Mitra S. Activation of apurinic/apyrimidinic endonuclease in human cells by reactive oxygen species and its correlation with their adaptive response to genotoxicity of free radicals. Proc Natl Acad Sci U S A 1998;95:50616.
(59) Marsin S, Vidal AE, Sossou M, Menissier-de Murcia J, Le Page F, Boiteux S, et al. Role of XRCC1 in the coordination and stimulation of oxidative DNA damage repair initiated by the DNA glycosylase hOGG1. J Biol Chem. 2003;278:4406874.
(60) Jaiswal M, LaRusso NF, Nishioka N, Nakabeppu Y, Gores GJ. Human Ogg1, a protein involved in the repair of 8-oxoguanine, is inhibited by nitric oxide. Cancer Res 2001;61:638893.
(61) Graziewicz M, Wink DA, Laval F. Nitric oxide inhibits DNA ligase activity: potential mechanisms for NO-mediated DNA damage. Carcinogenesis 1996;17:25015.
(62) Wink DA, Laval J. The Fpg protein, a DNA repair enzyme, is inhibitedby the biomediator nitric oxide in vitro and in vivo. Carcinogenesis 1994;15:21259.
(63) Laval F, Wink DA. Inhibition by nitric oxide of the repair protein, O6-methylguanine-DNA-methyltransferase. Carcinogenesis 1994;15:4437.
(64) Fujimoto H, Ando Y, Yamashita T, Terazaki H, Tanaka Y, Sasaki J, et al. Nitric oxide synthase activity in human lung cancer. Jpn J Cancer Res 1997;88:11908.[CrossRef][Web of Science][Medline]
(65) Ambs S, Bennett WP, Merriam WG, Ogunfusika MO, Oser SM, Kham MA, etal. Vascular endothelial growth factor and nitrite oxide synthase expression in human lung cancer and the relation to p53. Br J Cancer 1998;78:2339.[Web of Science][Medline]
(66) Dantzer F, Luna L, Bjoras M, Seeberg E. Human OGG1 undergoes serine phosphorylation and associates with the nuclear matrix and mitotic chromatin in vivo. Nucleic Acids Res 2002;30:234957.
(67) Ishida T, Takashima R, Fukayama M, Hamada C, Hippo Y, Fujii T, et al. New DNA polymorphisms of human MMH/OGG1 gene: prevalence of one polymorphism among lung-adenocarcinoma patients in Japanese. Int J Cancer 1999;80:1821.[CrossRef][Web of Science][Medline]
(68) Goode EL, Ulrich CM, Potter JD. Polymorphisms in DNA repair genes and associations with cancer risk. Cancer Epidemiol Biomarkers Prev 2002;11:151330.
(69) Wikman H, Risch A, Klimek F, Schmezer P, Spiegelhalder B, Dienemann H, et al. hOGG1 polymorphism and loss of heterozygosity (LOH): significance for lung cancer susceptibility in a caucasian population. Int J Cancer 2000;88:9327.[CrossRef][Web of Science][Medline]
(70) Le Marchand L, Donlon T, Lum-Jones A, Seifried A, Wilkens LR. Association of the hOGG1 Ser326Cys polymorphism with lung cancer risk. Cancer Epidemiol Biomarkers Prev 2002;11:40912.
(71) Sugimura H, Kohno T, Wakai K, Nagura K, Genka K, Igarashi H, et al. hOGG1 Ser326Cys polymorphism and lung cancer susceptibility. Cancer Epidemiol Biomarkers Prev 1999;8:66974.
Manuscript received April 21, 2004; revised September 30, 2004; accepted January 5, 2005.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
P. Rai, T. T. Onder, J. J. Young, J. L. McFaline, B. Pang, P. C. Dedon, and R. A. Weinberg Continuous elimination of oxidized nucleotides is necessary to prevent rapid onset of cellular senescence PNAS, January 6, 2009; 106(1): 169 - 174. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Krause, S. Karger, A. Schierhorn, S. Poncin, M.-C. Many, and D. Fuhrer Proteomic Profiling of Cold Thyroid Nodules Endocrinology, April 1, 2007; 148(4): 1754 - 1763. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




