Skip Navigation

JNCI Journal of the National Cancer Institute 2005 97(22):1645-1651; doi:10.1093/jnci/dji371
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (14)
Right arrow Request Permissions
Google Scholar
Right arrow Articles by Petty, W. J.
Right arrow Articles by Dmitrovsky, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Petty, W. J.
Right arrow Articles by Dmitrovsky, E.
Related Collections
Right arrowEditorial about this Article
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© 2005 Oxford University Press

ARTICLE

A Novel Retinoic Acid Receptor {beta} Isoform and Retinoid Resistance in Lung Carcinogenesis

W. Jeffrey Petty, Na Li, Adrian Biddle, Rebecca Bounds, Christopher Nitkin, Yan Ma, Konstantin H. Dragnev, Sarah J. Freemantle, Ethan Dmitrovsky

Affiliations of authors: Department of Pharmacology and Toxicology (WJP, NL, AB, RB, YM, SJF, ED), Department of Medicine (WJP, KHD, ED), Norris Cotton Cancer Center (KHD, ED), Dartmouth College (CN), Hanover, NH

Correspondence to: W. Jeffrey Petty, MD, Internal Medicine—Hematology and Oncology, Wake Forest University School of Medicine, Medical Center Blvd., Winston-Salem, NC 27157 (e-mail: wpetty{at}wfubmc.edu).


    ABSTRACT
 Top
 Notes
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Background: We previously reported that all-trans-retinoic acid (RA) treatment can prevent in vitro transformation of immortalized human bronchial epithelial (HBE) cells. Methods: To determine whether methylation inhibits RAR{beta} expression in HBE cells, we used sodium bisulfite sequencing to compare RAR{beta} P2 promoter methylation patterns in RA-sensitive (BEAS-2B) and RA-resistant (BEAS-2B-R1) HBE cells. Immunoblotting was used to assess induction of the RAR{beta}, placental transforming growth factor {beta} (PTGF-{beta}), Fos-related antigen 1 (Fra-1), and transglutaminase II (TGase II) proteins by RA following treatment with azacitidine, a DNA demethylating agent. The expression, transcriptional activity, and growth suppressive activity of RAR{beta}1', a novel RAR isoform, were evaluated in lung cancer cells transfected with RAR{beta}1', and expression was also studied in paired normal lung tissues and lung tumors. All statistical tests were two-sided. Results: Hypermethylation was observed in the 3' region of the RAR{beta} P2 promoter of BEAS-2B-R1 but not BEAS-2B cells. Azacitidine treatment of BEAS-2B-R1 cells restored RA-inducible RAR{beta}2 and PTGF-{beta} expression but not that of RAR{beta}1', Fra-1, or TGase II. RAR{beta}1' expression was repressed in RA-resistant BEAS-2B-R1 cells and in lung cancers, compared with adjacent normal lung tissues. BEAS-2B-R1 cells transiently transfected with RAR{beta}1' had increased RA-dependent activation of a retinoic acid receptor element (RARE)–containing reporter plasmid compared with vector control (mean = 3.2, 95% confidence interval [CI] = 3.1 to 3.3 versus mean = 1.4, 95% CI = 1.3 to 1.5; P<.001). In H358 lung cancer cells transiently transfected with RAR{beta}1', RA treatment restored target gene expression compared with that in vector-transfected cells and suppressed cell growth compared with that in untreated cells (4 µM; treated mean = 0.49 versus untreated mean = 1.0, difference = 0.51, 95% CI = 0.35 to 0.67, P = .003; 8 µM: treated mean = 0.50 versus untreated mean = 1.0, difference = 0.50, 95% CI = 0.26 to 0.74, P = .015). Conclusion: Restoration of RAR{beta}1' expression may overcome retinoid resistance in lung carcinogenesis.



    INTRODUCTION
 Top
 Notes
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Vitamin A deficiency has been reported to cause preneoplastic changes in the bronchial epithelium and to be associated with an increased risk of lung cancer (1,2). Although results from initial clinical trials support a role for retinoids (natural and synthetic derivatives of vitamin A) in the chemoprevention of aerodigestive tract cancers (3,4), data from randomized trials suggest that carotenoids or retinoids are not effective for lung cancer chemoprevention in the general population, although a benefit may exist for nonsmokers (58). Clinical resistance to classical retinoids has been seen in lung cancer and is due, at least in part, to loss of retinoic acid receptors {beta} (RAR{beta}) expression during lung carcinogenesis (918). Loss of RAR{beta} expression is often caused by genomic loss or epigenetic silencing due to genomic methylation or histone deacetylation (11,19). Hypermethylation of the RAR{beta} promoter is an early event in lung carcinogenesis and is one of the most frequent methylation defects detected in the histopathologically normal bronchial epithelium of heavy smokers (20). However, whether loss of RAR{beta}2 expression due to RAR{beta} promoter methylation explains clinical resistance to RA is unknown.

We previously reported that all-trans-retinoic acid (RA) treatment can prevent in vitro transformation of immortalized human bronchial epithelial (HBE) cells and that this chemoprevention involves the proteasome-dependent degradation of G1 cyclins (21,22). In a later study, we derived an RA-resistant HBE cell line (BEAS-2B-R1) by selecting RA-sensitive (BEAS-2B) HBE cells with increasing concentrations of RA. Unlike parental BEAS-2B cells, BEAS-2B-R1 cells treated with RA do not degrade cyclin D1 or cyclin E or undergo G1 arrest (23). RA treatment does not induce RAR{beta} or RA target gene expression in these cells (23,24).

In the present study, we used BEAS-2B-R1 RA-resistant HBE cells to investigate mechanisms responsible for RAR{beta} silencing. We studied the methylation status of the RAR{beta} P2 promoter, which is hypermethylated in certain lung cancer cells that lack RAR{beta}2 expression (11). We then investigated whether treatment with the DNA demethylating agent azacitidine (also known as 5-azacytidine), alone or in combination with RA treatment, would restore RAR{beta} expression and thereby induce the expression of previously identified retinoid target genes in BEAS-2B-R1 cells. Also, we investigated the structure, expression, and function of RAR{beta}1', a previously unrecognized RAR{beta} isoform, in lung cancer cells and in lung tumors and adjacent normal lung tissues.


    MATERIALS AND METHODS
 Top
 Notes
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Cell Culture

BEAS-2B and BEAS-2B-R1 cells were cultured in serum-free LHC-9 media in the dark at 37 °C with 5% CO2 in a humidified incubator as previously described (23,24). H358, H441, and A549 lung cancer cell lines and COS African green monkey kidney fibroblast cells were obtained and passaged as recommended by American Type Culture Collection (Manassas, VA). H358, H441, and COS cell lines were cultured in RPMI media containing L-glutamine and 10% fetal bovine serum (FBS) supplemented with 100 IU/mL of penicillin and 100 µg/mL of streptomycin. A549 cells were cultured in Ham's F12 media containing L-glutamine and 10% FBS supplemented with 100 IU/mL of penicillin and 100 µg/mL of streptomycin.

Compounds and Treatments

RA and trichostatin A (Sigma Chemicals, St. Louis, MO) were prepared as 10 mM stock solutions in dimethyl sulfoxide (DMSO) and stored in liquid nitrogen. Azacitidine was obtained from the National Cancer Institute (Bethesda, MD) and dissolved in phosphate-buffered saline, pH 6.3. Trichostatin A treatment was performed at a dosage of 200 nM for 48 hours. Azacitidine treatment was performed at a dosage of 1 µM for 48 hours.

Tumor Acquisition

Non–small-cell lung tumors and paired normal lung tissues were acquired as part of a Dartmouth-Hitchcock Medical Center Institutional Review Board (IRB)–approved tumor acquisition protocol. The banked tissues do not carry patient identifiers and are exempt from IRB review under the Code of Federal Regulation Title 45, part 46.

Genomic DNA Methylation Sequencing

Genomic DNA was isolated from BEAS-2B and BEAS-2B-R1 cells using TRI Reagent (Molecular Research Center, Cincinnati, OH) per the manufacturer's protocol and was modified with sodium bisulfite, which converts unmethylated cytosine to uracil and amplified by polymerase chain reaction (PCR) using established techniques and primers that are specific for bisulfite-modified DNA: 5'-AAGTGAGTTGTTTAGAGGTAGGAGGG-3' (sense) and 5'-CCTATAATTAATCCA AATAATCATTTACC-3' (antisense) (11). PCR products were then independently ligated into the TOPO-TA cloning vector (Invitrogen, Carlsbad, CA) using the manufacturer's protocol, transfected into One Shot competent cells (Invitrogen) per the manufacturer's protocol, selected on ampicillin-containing agarose plates, and individually expanded for analyses. Eight independent clones from each reaction were sequenced using established techniques (25) to assess the methylation frequency of each CG doublet in the RAR{beta} P2 promoter, which has been identified as hypermethylated in lung cancer cells that lack RAR{beta}2 expression. The genomic sequence of the region studied (nucleotides +106 to +250) is as follows: 5'-CGAGAACGCGAGCGATCCGAG CAGGGTTTGTCTGGGCACCGTCGGGGTAGGATCCGGAACGCATTCGGAAGGCTTTTTGCAAGCATTTACTTGGAAGGAGAACTTGGGATCTTTCTGGGAACCCCCCGCCCCGGCTGGATTGGCC-3'.

Protein Extraction and Immunoblot Analysis

Immunoblot analyses of extracts from the described experiments were performed using previously optimized techniques (23). In brief, protein extracts were obtained by lysing cells in radioimmunoprecipitation assay buffer (10 mM Tris, 5 mM EDTA, 150 mM NaCl, 1% sodium deoxycholate, 1% Triton X-100, 0.1% sodium dodecyl sulfate, 1 mM NaF, and 1 mM sodium orthovanadate) followed by centrifugation at 10 000g for 15 minutes at 4 °C. The protein concentration of the supernatant was assayed using the Bradford method (Bio-Rad, Hercules, CA). Proteins were separated by sodium dodecyl sulfate–10% polyacrylamide gel electrophoresis and electrophoretically transferred to nitrocellulose membranes for immunoblot analyses as previously described (23).

Primary antibodies to RAR{beta} (rabbit polyclonal, 1 : 500), actin (goat polyclonal, 1 : 1000), placental transforming growth factor {beta} (PTGF-{beta}; goat polyclonal, 1 : 500), and Fos-related antigen 1 (Fra-1; rabbit polyclonal, 1 : 500) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). The transglutaminase II (TGase II; mouse monoclonal, 1 : 500) antibody was purchased from NeoMarkers (Fremont, CA). Species-appropriate mouse or rabbit (Amersham Biosciences Corporation, Piscataway, NJ) or goat (Santa Cruz Biotechnology) horseradish peroxidase–conjugated secondary antibodies were applied at a dilution of 1 : 3000 and binding was visualized using chemiluminescence (ECL Plus; Amersham Biosciences Corporation). Blocking peptide studies were performed for RAR{beta} immunoblots of normal lung protein using a peptide specific to the C terminus of RAR{beta}, per the manufacturer's protocol (Santa Cruz Biotechnology). The specificity of the RAR{beta}1' band was confirmed by identifying the complete loss of the RAR{beta}1' band in an immunoblot probed with the blocking peptide with the presence of the band in an immunoblot probed without blocking peptide performed simultaneously under otherwise identical conditions.

Reverse Transcription–PCR Amplification of RAR{beta} Isoforms

Total RNA was extracted from BEAS-2B cells, normal lung tissues, and malignant lung tissues using TRI Reagent (Molecular Research Center) per the manufacturer's protocol. RAR{beta} isoforms were PCR amplified with cDNA generated from 1 µg of total RNA from each sample using the First-Strand cDNA synthesis system (Invitrogen) per the manufacturer's protocol. Annealing temperatures for the reactions were optimized for each primer pair. First-round amplification was performed for 35 cycles. Nested amplification was performed for 10 cycles using 5 µL of the first-round PCR product. Primers used to amplify RAR{beta} isoforms were as follows: RAR{beta}1, 5'-TGACGTCAGCAGTGACTACTG-3' (sense) and 5'-GTGGTTGAACTGCACATTCAGA-3' (antisense); RAR{beta}2 and RAR{beta}4, 5'-AACGCGAGCGATCCGAGCAG-3' (sense) and 5'-ATTTGTCCTGGCAGACGAAG CA-3' (antisense); and RAR{beta}1', 5'-ATGAGGAATGAAGCTGAGTAGA-3' (sense) and 5'-ATTTGTCCTGGCAGACGAAGCA-3' (antisense) (26).

5' Rapid Amplification of cDNA Ends PCR

RACE-Ready cDNA from human lung was purchased from Invitrogen. Two primers complementary to the fourth exon of RAR{beta} were designed for nested 5' rapid amplification of cDNA ends (5'-RACE) PCR amplification of RAR{beta} isoforms: first-round primer 5'-ACTTGGTGG CCAGTTCACTGAATTTGT-3' and second-round primer 5'-CCTGGCAGACGAAGCAGGGTTTGTA-3'. RACE products were cloned using the TOPO-TA vector (Invitrogen) and were sequenced as described previously (25). One of the products identified was a novel RAR{beta} isoform, designated RAR{beta}1', which was registered as GenBank accession number DQ083391.

Luciferase Assay

The cloned products from the 5'-RACE PCR amplification were digested with EcoRI and XhoI restriction endonucleases (New England Biolabs, Beverly, MA) to release the exon 4 segment. An existing RAR{beta}2-pSG5 construct containing the full length RAR{beta}2 cDNA in the pSG5 expression vector was also digested with appropriate restriction endonucleases. The size-fractionated fragments were gel purified and the 5' portion of RAR{beta}1' was ligated into a truncated 3' portion of the RAR{beta}-pSG5 segment at exon 4 using T4 DNA ligase (Invitrogen) forming an RAR{beta}1'-pSG5 expression construct. Sequencing was performed on separate clones to confirm the presence of the desired construct. COS kidney fibroblast cells and BEAS-2B-R1 cells were both cotransfected with the RAR{beta}1' expression plasmid, the RAR{beta}2 expression plasmid, or empty vector, and with a retinoic acid response element–thymidine kinase (RARE-TK) fusion gene construct containing a firefly luciferase reporter gene, and a TK–Renilla luciferase reporter gene construct (as a control for transfection efficiency) using the FuGENE transfection system (Roche Diagnostics, Basel, Switzerland) according to the manufacturer's protocol. All transfections were performed in quadruplicate. BEAS-2B-R1 cells were cultured without exogenous RA for 7 days before transfection. Cells were then treated with RA at various doses or with vehicle (DMSO) for 3 hours. Luciferase activity was determined using the Dual Luciferase Reporter System (Promega, Madison, WI). Firefly luciferase measurements were normalized to Renilla luciferase measurements as a control for transfection efficiency.

RAR{beta}1' Transfection and Proliferation Assays

To investigate the function of RAR{beta}1', we cotransfected H358 lung cancer cells with a puromycin resistance expression vector (p-Pur, BD Biosciences, Mountain View, CA) and with either the RAR{beta}1' expression vector or an insertless vector (pSG5). Cells were then treated with 2 µg/mL of puromycin for 24 hours to select against untransfected H358 cells. After 7 days, cells were plated in 96-well plates at a density of 3 x 103 cells per well for proliferation assays. Cellular proliferation was measured using the CellTiter-Glo assay kit (Promega). Assays were performed in triplicate. Basal luminescence activity and an ATP standard curve were each determined. Cells were then treated with either 4 µM of RA or with DMSO (vehicle) for 24 hours. Luminescence activity and an ATP standard curve were determined each day that the assay was performed. Growth rates were calculated by subtracting the basal ATP content from ATP content measured after RA or vehicle treatments, as described previously (25). Growth rates were normalized to that of vehicle-treated cells.

Statistical Methods

Differences between groups of continuous variables were assessed using the two-sample t test. P<.05 (two-sided) was considered statistically significant.


    RESULTS
 Top
 Notes
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
RAR{beta} P2 Promoter Methylation and RA-Induced Expression of Target Genes

To determine the methylation status of the RAR{beta} P2 promoter was different in RA-sensitive (BEAS-2B) and RA-resistant (BEAS-2B-R1) HBE cells, we assayed the CG-methylation pattern of the P2 promoter in each cell line using bisulfite modification and PCR sequencing. Independent determinations of the RAR{beta} P2 promoter methylation pattern in BEAS-2B and BEAS-2B-R1 cells revealed that most CG doublets were methylated (in ≥50% of samples) in both cell lines. The CG doublets at the 3' region of this promoter were more frequently methylated in BEAS-2B-R1 than in BEAS-2B cells (Fig. 1).



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 1. DNA methylation patterns of the RAR{beta} P2 promoter in BEAS-2B and BEAS-2B-R1 cells. Genomic DNA purified from BEAS-2B and BEAS-2B-R1 cells was subjected to sodium bisulfite modification and polymerase chain reaction (PCR) amplification. PCR products were cloned and eight individual clones from each reaction were sequenced. A) Relative positions in the promoter of methylated and unmethylated CpG islands in each cell line. The genomic DNA sequence of this region is listed in "Materials and Methods." Numbers listed indicate nucleotide positions relative to the initiation of RAR{beta}2 transcription (solid circles, ≥50% cytosine methylation; open circles, <50% cytosine methylation). B) Percentages of clones (y-axis) that demonstrated methylated cytosines at the nucleotide sites specified (x-axis). Most P2 promoter residues were methylated in both BEAS-2B (gray bars) and BEAS-2B R1 (black bars) cells. By contrast, CpG islands at the 3' region of the P2 promoter were more often methylated in BEAS-2B-R1 than in BEAS-2B cells.

 
We previously showed that BEAS-2B-R1 cells do not express RAR{beta} after RA treatment, whereas BEAS-2B cells do. To determine if RA-inducible RAR{beta} expression could be restored to BEAS-2B-R1 cells by demethylation, BEAS-2B-R1 cells were treated with azacitidine, a demethylating agent, or with trichostatin A, a histone deacetylase inhibitor. Pretreatment with 1 µM azacitidine for 48 hours restored RA-inducible RAR{beta} expression (Fig. 2), whereas pretreatment with 200 nM trichostatin A for 48 hours did not (data not shown). A second RAR{beta} immunoreactive protein that migrated at 47 kDa was identified in BEAS-2B cells but was repressed in BEAS-2B-R1 cells (Fig. 2). The expression of this protein was not induced by RA treatment, azacitidine treatment, or combined RA and azacitidine treatments. The expression of the other RAR{beta} and RXR isoforms was similar in BEAS-2B-R1 and BEAS-2B cells (data not shown).



View larger version (36K):
[in this window]
[in a new window]
 
Fig. 2. Immunoblot analysis of RAR{beta} protein expression in BEAS-2B and BEAS-2B-R1 cells following azacitidine (5-AZA) and/or all-trans-retinoic acid (RA) treatments. BEAS-2B and BEAS-2B-R1 cells were treated with 1µM of azacitidine for 48 hours followed by 4 µM of RA for 24 hours or treated with 5-AZA or RA alone. A novel RAR{beta} immunoreactive protein, RAR{beta}1', with a molecular mass of 47 kDa was detected in BEAS-2B cells. Molecular mass markers are shown at right. RAR{beta}2 is approximately 55 kDa (doublet). Actin was used as a control for protein loading and transfer.

 
Protein expression of several RA target genes that were previously identified as being induced by RA in BEAS-2B cells but not in BEAS-2B-R1 cells were assessed after treatment with various combinations of RA and azacitidine or with vehicle. Azacitidine treatment restored the RA induction of PTGF{beta} expression to BEAS-2B-R1 cells but not RA-inducible expression of TGase II or Fra-1 (Fig. 3).



View larger version (63K):
[in this window]
[in a new window]
 
Fig. 3. Immunoblot analysis of all-trans-retinoic acid (RA)-target gene expression before and after RA, azacitidine (5-AZA), or combined azacitidine and RA treatments of BEAS-2B-R1 cells. BEAS-2B-R1 cells were treated with 1 µM of azacitidine or vehicle (dimethyl sulfoxide) for 48 hours followed by treatment with 4 µM RA or vehicle for 24 hours. Target genes previously shown to be transcriptionally repressed in BEAS-2B-R1 cells were assessed by immunoblot analyses. Analysis of RAR{beta}2, placental transforming growth factor {beta} (PTGF{beta}), Fos-related antigen 1 (Fra-1), and transglutaminase II (TGase II) were performed in three independent experiments. Actin was used as a control for protein loading and transfer.

 
Identification of a Novel RAR{beta} Isoform

To identify the second RAR{beta} protein repressed in BEAS-2B-R1 cells, we performed PCR analyses of RAR{beta}1, RAR{beta}2, and RAR{beta}4 using published techniques (26). However, these RAR{beta} isoforms were not amplified from BEAS-2B cDNA. To investigate the possible existence of a novel RAR{beta} isoform, we performed 5' RACE–PCR analysis using RNA derived from normal human lung tissue. The first round of PCR amplified several dominant species (Fig. 4, A), of which the largest species represented splice variants of RAR{beta}2 and the smallest represented a novel isoform of RAR{beta} present in normal human lung. Reverse transcription–PCR analysis confirmed the expression of this isoform in BEAS-2B cells (data not shown). This isoform contains an upstream exon spliced into exon 3 of RAR{beta} with an in-frame start codon. This previously unrecognized RAR{beta} isoform was designated as RAR{beta}1'. The genomic structure of this isoform is shown in Fig. 4, B.



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 4. Expression of RAR{beta}1' in RNA derived form normal human lung tissue. A) 5' rapid amplification of cDNA ends-labeled cDNA was subjected to polymerase chain reaction (PCR) amplification using primers complementary to exon 4 of human RAR{beta}. DNA sequence analyses of separate clones determined that the indicated largest species represent splice variants of RAR{beta}2 and the smallest species (680 bp) revealed a novel isoform containing an in-frame AUG start codon. The 100-bp size ladder is shown at right. B) Genomic structure of the 5' regions of RAR{beta}2, RAR{beta}4, and the novel isoform, RAR{beta}1'. Arrows mark the initiation of transcription.

 
Transient Transfection of BEAS-2B-R1 cells with RAR{beta}1'

Translation of RAR{beta}4 or RAR{beta}5 arising from a downstream start codon produces a low-molecular-weight RAR{beta} protein that inhibits RA-induced transactivation of an RARE-containing reporter construct (27,28). To determine whether the small novel RAR{beta}1' also inhibits RA-inducible transactivation of RARE, we cotransfected BEAS-2B-R1 and COS cells with RAR{beta}1', RAR{beta}2, or empty vector and with a RARE-containing reporter gene construct. We then treated transfected cells with RA or DMSO (vehicle control). Cells transfected with RAR{beta}1' or RAR{beta}2 had higher RA-induced activation of the RARE reporter construct transfected cells (mean = 3.2, 95% confidence interval [CI] = 3.1 to 3.3, P<.001, and mean = 2.8, 95% CI = 2.6 to 3.0, P<.001, respectively) than vector-transfected cells (mean = 1.4, 95% CI = 1.3 to 1.5) (Fig. 5). A similar pattern of induction was observed in COS cells, although the basal reporter gene activity was not increased relative to vector transfectants in these cells, which were cultured without exogenous RA (data not shown), unlike BEAS-2B-R1 cells, which were grown in media supplemented with RA (23).



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 5. Cotransfection of RAR{beta}1' or RAR{beta}2 and transcriptional activation of a retinoic acid response element (RARE)–containing reporter plasmid. BEAS-2B-R1 cells were transiently cotransfected with an empty vector, RAR{beta}1', or RAR{beta}2 and with an RARE-containing reporter gene (luciferase) plasmid. Transfectants were then treated with 4 µM of RA (black bars) or with dimethyl sulfoxide (gray bars) for 3 hours. A dual luciferase assay was used to measure RARE transcriptional activity. Firefly luciferase measurements were normalized to Renilla luciferase measurements as a control for transfection efficiency. Data shown represent normalized reporter activities. Means and 95% confidence intervals of four replicates are shown. *, P<.001, RAR{beta}1'- or RAR{beta}2-transfected RA-treated cells compared with vector-transfected RA-treated cells, as determined by two-sided t test.

 
RAR{beta}1' Expression in Lung Cancer Cell Lines and in Paired Normal and Malignant Lung Tissues

The relative expression of RAR{beta}1' in lung cancers was sought using lung cancer cell lines as well as paired normal and malignant lung tissues. The RA response of several lung cancer cell lines was assessed by determining growth response following 4 µM RA treatment for 72 hours. The patterns of RAR{beta}1' and RAR{beta}2 expression in these cells, as determined by immunoblot analyses, were compared with those in RA-responsive BEAS-2B HBE cells. RAR{beta}2 protein was abundantly expressed in A549 cells and barely detected in untreated H358 and H441 cells (Fig. 6, A). By contrast, RAR{beta}1' protein expression was substantially lower in all three lung cancer cell lines than in BEAS-2B HBE cells (Fig. 6, A). Furthermore, when three sets of paired malignant and normal tissues were compared, RAR{beta}1' protein expression in de novo lung cancers was consistently lower than that of normal lung tissues (Fig. 6, B). The identity of this protein was confirmed with a blocking peptide specific for the C terminus of RAR{beta} (data not shown). Another set of paired malignant and normal lung tissue with available RNA was subjected to reverse transcription–PCR analysis, from which RAR{beta}1' RNA was detected in the normal lung tissue but not in the paired malignant tissue (data not shown).



View larger version (59K):
[in this window]
[in a new window]
 
Fig. 6. Expression of RAR{beta} immunoreactive proteins in lung cancer cell lines and lung cancers and paired normal lung tissue. A) Total protein was independently isolated from untreated BEAS-2B (RA sensitive) cells and from A549, H358, and H441 (RA resistant) cells and was subjected to immunoblot analyses for RAR{beta} expression using a polyclonal antibody directed against the C terminus of RAR{beta} that recognizes all RAR{beta} isoforms. B) Proteins isolated from paired normal (N) and malignant (T) lung tissues from three patients (cases).

 
Growth Suppression in RA-resistant Lung Cancer Cells Transfected with RAR{beta}1'

We then studied the functional consequences of restoring RAR{beta}1' expression in lung cancer cells. RA treatment slightly increased expression of RAR{beta}2 and strongly increased that of the RA target gene PTGF-{beta} in H358 cells (Fig. 7, A). To determine whether exogenous RAR{beta}1' expression in RA-resistant cells would restore the growth-suppressive effects of RA treatment, we stably transfected H358 cells with either RAR{beta}1'-pSG5 or an empty expression vector (pSG5) as a control. Transfected cells were then treated with RA or vehicle for 24 hours. RA treatment at 4 and 8 µM dosages had no effect on the growth of control cells (Fig. 7, B). In RAR{beta}1' transfected cells, by contrast, RA treatment suppressed growth (4 µM: treated mean = 0.49 versus untreated mean = 1.0, difference = 0.51, 95% CI on the difference = 0.35 to 0.67, P = .003; 8 µM: treated mean = 0.50 versus untreated mean = 1.0, difference = 0.50, 95% CI on the difference = 0.26 to 0.74, P = .015; Fig. 7, B). Engineered expression of RAR{beta}1' in H358 cells was also associated with restored RA induction of the RA target gene, TGase II (Fig. 7, C). By image quantification, TGase II expression was 2.4-fold greater in RA-treated RAR{beta}1'-transfected cells than that in RA-treated control vector-transfected cells.



View larger version (37K):
[in this window]
[in a new window]
 
Fig. 7. Effect of all-trans-retinoic acid (RA) treatment of RAR{beta}1'-transfected H358 lung cancer cells on expression of RAR{beta}2 and RA target genes. A) H358 cells were treated with 4 µM of RA or dimethyl sulfoxide (DMSO) as a vehicle for 24 hours followed by immunoblot analyses of RAR{beta}2, placental transforming growth factor {beta} (PTGF{beta}), and transglutaminase II (TGase II). Actin was probed as a control for protein loading. B) H358 cells were stably transfected with RAR{beta}1'-pSG5 expression vector or an insertless vector (pSG5). Vector (gray bars) and RAR{beta}1' (black bars)—transfectants were treated with 4 µM or 8 µM of RA for 24 hours. Proliferation rates were normalized to vehicle (DMSO)-treated control cells. Means and 95% confidence intervals for three replicates are shown. *, P = .003 and {dagger}, P = .015 as determined by two-sided t test. C) H358 cells were transiently transfected with either RAR{beta}1'-pSG5 vector or an insertless pSG5 vector. Transfectants were independently treated with vehicle (DMSO) or 4 µM of RA for 12, 24, or 48 hours. Total protein isolated was subjected to immunoblot analysis for transglutaminase II (TGase II) and actin, as a loading control.

 

    DISCUSSION
 Top
 Notes
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
By investigating an RA-resistant HBE cell line BEAS-2B-R1 (derived by treating with increasing concentrations of RA), we have identified the existence of a novel RAR{beta} isoform, RAR{beta}1'. This isoform was expressed in normal lung and in RA-sensitive BEAS-2B cells but not in RA-resistant BEAS-2B-R1 cells, lung cancer cell lines, or clinical lung cancers. Transfection of this isoform into an RA-resistant lung cancer cell line, H358, that expresses low levels of RAR{beta}2 conferred RA target gene induction and growth suppression following RA treatment. Thus, RAR{beta}1' has distinct biologic properties compared with RAR{beta}2 and appears to function as a tumor suppressor in lung carcinogenesis.

Repression of RAR{beta} is often observed in lung carcinogenesis and likely confers resistance to the growth-suppressive effects of vitamin A and its derivatives (920). In this study, a specific domain of the RAR{beta} P2 promoter was found to be hypermethylated in RA-resistant HBE cells that in turn led to RAR{beta} silencing. This region of the P2 promoter appears to serve a key role in methylation-mediated silencing of RAR{beta} in the lung. Consistent with this hypothesis, a murine model of tobacco-induced lung carcinogenesis highlighted a similar region of promoter methylation that conferred RAR{beta} silencing (16).

In this study, we observed not only that RAR{beta}2 and RAR{beta}1' have distinct functions but also that their expression is regulated differentially. Although neither RAR{beta}2 nor RAR{beta}1' was expressed in RA-resistant BEAS-2B-R1 HBE cells, pretreatment with azacitidine restored only RA-dependent RAR{beta}2 expression but not expression of RAR{beta}1'. This increased RAR{beta}2 expression was accompanied by increased expression of only one of the other RA target genes assayed, PTGF-{beta}. Thus, we hypothesized that RAR{beta}1' is required for the efficient induction of those RA target genes that were not restored by azacitidine treatment alone or by combined RA and azacitidine treatments. In support of this view, cotransfection of BEAS-2B-R1 cells with RAR{beta}1' and an RA-responsive reporter gene enhanced retinoid trans-activation of the RARE reporter construct. Also, exogenous expression of RAR{beta}1' in the H358 RA-resistant lung cancer cell line, which only slightly increases expression of RAR{beta}2 following RA treatment, led to RA-dependent growth suppression and RA target gene induction, whereas no growth suppression was observed in H358 cells after RA treatment. These results strongly suggest that RAR{beta}1' has a critical role in retinoid signaling in lung carcinogenesis. Furthermore, the observation that the expression of RAR{beta}1' was repressed in BEAS-2B-R1 HBE and lung cancer cell lines and in lung cancer samples (but not in paired normal lung tissue) suggests that deregulation of this previously unrecognized RAR{beta} isoform is important for conferring RA resistance. Restored expression of RAR{beta}1' may only partially restore retinoid response. It is also possible that loss of RAR{beta}1' expression will be necessary but not sufficient for conferring retinoid resistance. Further understanding of the role of RAR{beta}1' in response to retinoids would be gained by selective knockdown of RAR{beta}1'.

Azacitidine treatment of RA-resistant HBE cells conferred RA-dependent induction of RAR{beta}2 expression and the activation of specific RA target genes. The results indicate that combining retinoids with a DNA demethylating agent might restore RAR{beta}2 expression to lung cancer cells (11,2931). However, for an epigenetic targeting strategy to restore the full induction of RAR{beta} target genes, the basis for RAR{beta}1' repression needs to be determined. RAR{beta}1' transcription is likely initiated by a distinct promoter near the first exon of this isoform. We did not find a classical RARE sequence in the promoter (data not shown), which is consistent with the inability of RA to induce RAR{beta}1' expression (Fig. 2). Characterization of the RAR{beta}1' promoter, regions of genomic DNA methylation, and histone acetylation changes within this region are the subject of future work. Combined treatment with a DNA demethylating agent and a histone deacetylase inhibitor might prove useful for restoring the expression and function of RAR{beta}1'. For the success of this and other targeted approaches in lung cancer therapy, proof-of-principle studies are needed that confirm whether pharmacologic mechanisms identified in vitro are also engaged in the clinical setting (25). In this regard, studies to investigate the benefits of combining retinoids with chromatin-modifying drugs should evaluate changes in specific retinoid receptor isoforms as well as their target genes that would directly confer retinoid biologic effects (24).

This study is limited in part due to the number of cell lines studied. Future work will seek to extend our findings by investigating the effects of RAR{beta}1' expression in more cancer cell lines. Restored expression of RAR{beta}1' may restore retinoid sensitivity only in certain cell contexts. Furthermore, selective knockdown of RAR{beta}1' will be necessary to determine whether loss of this species is sufficient to confer retinoid resistance.

Taken together, the data presented here directly implicate a critical role for RAR{beta}1' in mediating retinoid biologic effects in the lung and perhaps other organ sites. RAR{beta}1' itself could serve as a novel molecular pharmacologic target. The frequent repression of RAR{beta}1' in lung carcinogenesis underscores its likely important biologic or clinical role. RAR{beta}1' repression, despite RA treatment, offers a mechanistic explanation for clinical retinoid resistance that has been reported previously (7,8). Identification of pharmacologic approaches that restore RAR{beta}1' expression would provide a basis for future retinoid-based combination strategies for lung cancer therapy or chemoprevention.


    NOTES
 Top
 Notes
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Supported by the National Institutes of Health and National Cancer Institutes R01-CA87546 (E. Dmitrovsky), R01-CA62275 (E. Dmitrovsky), R01-CA111422 (E. Dmitrovsky), a Samuel Waxman Foundation Cancer Research Award (E. Dmitrovsky), and the Oracle Giving Fund (E. Dmitrovsky), as well as a CHEST Foundation of the American College of Chest Physicians and LUNGevity Foundation Clinical Research Award in Lung Cancer (W. J. Petty), an American Society of Clinical Oncology Young Investigator Award (W. J. Petty), and the National Institutes of Health grant T32-CA009658 (W. J. Petty).

We thank Dr. Christopher H. Lowrey (Dartmouth Medical School) for providing his expertise and assistance in the sodium bisulfite sequencing experiments.

W. J. Petty's former mailing address was Department of Pharmacology and Toxicology, Dartmouth Medical School, Dartmouth College, Hanover, NH 03755.

Funding to pay the Open Access publication charges for this article were provided by the Section on Hematology and Oncology, School of Medicine, Wake Forest University.


    REFERENCES
 Top
 Notes
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

(1) Sporn MB, Dunlop NM, Newton DL, Smith JM. Prevention of chemical carcinogenesis by vitamin A and its synthetic analogs (retinoids). Fed Proc 1976;35:1332–8.[ISI][Medline]

(2) Dogra SC, Khanduja KL, Gupta MP. The effect of vitamin A deficiency on the initiation and post-initiation phases of benzo(a)pyrene-induced lung tumorigenesis in rats. Br J Cancer 1985;52:931–5.[Medline]

(3) Hong WK, Lippman SM, Itri LM, Karp DD, Lee JS, Byers RM, et al. Prevention of second primary tumors with isotretinoin in squamous-cell carcinoma of the head and neck. N Engl J Med 1990;323:795–801.[Abstract]

(4) Pastorino U, Infante M, Maoli M, Chiesa G, Buyse M, Firket P, et al. Adjuvant treatment of stage I lung cancer with high-dose vitamin A. J Clin Oncol 1993;11:1216–22.[Abstract/Free Full Text]

(5) The alpha-Tocopherol, beta-Carotene Cancer Prevention Study Group. The effect of vitamin E and beta carotene on the incidence of lung cancer and other cancers in male smokers. N Engl J Med 1994;330:1029–35.[Abstract/Free Full Text]

(6) Hennikens CH, Buring JE, Manson GE, Stampfer M, Rosner B, Cook NR, et al. Lack of effect of long-term supplementation with beta carotene on the incidence of malignant neoplasms and cardiovascular disease. N Engl J Med 1996;334:1145–9.[Abstract/Free Full Text]

(7) Omenn GS, Goodman GE, Thornquist ND, Balmes J, Cullen MR, Glass A, et al. Effects of the combination of beta carotene and vitamin A on lung cancer and cardiovascular disease. N Engl J Med 1996;334:1150–5.[Abstract/Free Full Text]

(8) Lippman SM, Lee JJ, Karp DD, Vokes EE, Benner SE, Goodman GE, et al. Randomized Phase III intergroup trial of isotretinoin to prevent second primary tumors in stage I non-small cell lung cancer. J Natl Cancer Inst 2001;93:605–18.[Abstract/Free Full Text]

(9) Freemantle SJ, Spinella MJ, Dmitrovsky E. Retinoids in cancer therapy and chemoprevention: promise meets resistance. Oncogene 2003;22:7305–15.[CrossRef][ISI][Medline]

(10) Xu XC, Sozzi G, Lee JS, Lee JJ, Pastorino U, Pilotti S, et al. Suppression of retinoic acid receptor beta in non-small-cell lung cancer in vivo: implications for lung cancer development. J Natl Cancer Inst 1997;89:624–9.[Abstract/Free Full Text]

(11) Virmani AK, Rathi A, Zochbauer-Muller S, Sacchi N, Fukuyama Y, Bryant D, et al. Promoter methylation and silencing of the retinoic acid receptor-beta gene in lung carcinomas. J Natl Cancer Inst 2000;92:1303–7.[Abstract/Free Full Text]

(12) Zhang XK, Liu Y, Lee MO, Pfahl M. A specific defect in the retinoic acid receptor associated with human lung cancer cell lines. Cancer Res 1994;54:5663–9.[Abstract/Free Full Text]

(13) Xu XC, Ro JY, Lee JS, Shin DM, Hong WK, Lotan R. Differential expression of nuclear retinoid receptors in normal, premalignant, and malignant head and neck tissues. Cancer Res 1994;54:3580–7.[Abstract/Free Full Text]

(14) Houle B, Rochette-Egly C, Bradley WE. Tumor-suppressive effect of the retinoic acid receptor beta in human epidermoid lung cancer cells. Proc Natl Acad Sci U S A 1993;90:985–9.[Abstract/Free Full Text]

(15) Lotan R, Xu XC, Lippman SM, Ro JR, Lee JS, Lee JJ, et al. Suppression of retinoic acid receptor-beta in premalignant oral lesion and its up-regulation by isotretinoin. N Engl J Med 1995;332:1405–10.[Abstract/Free Full Text]

(16) Vuillemenot BR, Pulling LC, Palmisano WA, Hutt JA, Belinsky SA. Carcinogen exposure differentially modulates RAR-beta promoter hypermethylation, an early and frequent event in mouse lung carcinogenesis. Carcinogenesis 2004;25:623–9.[Abstract/Free Full Text]

(17) Youssef EM, Lotan D, Issa JP, Wakasa K, Fan YH, Mao L, et al. Hypermethylation of the retinoic acid receptor-beta(2) gene in head and neck carcinogenesis. Clin Cancer Res 2004;10:1733–42.[Abstract/Free Full Text]

(18) Sun SY, Wan H, Yue P, Hong WK, Lotan R. Evidence that retinoic acid receptor beta induction by retinoids is important for tumor cell growth inhibition. J Biol Chem 2000;275:17149–53.[Abstract/Free Full Text]

(19) Suh YA, Lee HY, Virmani A, Wong J, Mann KK, Miller WH, et al. Loss of retinoic acid receptor beta gene expression is linked to aberrant histone H3 acetylation in lung cancer cell lines. Cancer Res 2002;62:3945–9.[Abstract/Free Full Text]

(20) Zochbauer-Muller S, Lam S, Toyooka S, Virmani AK, Toyooka K, Seidl S, et al. Aberrant methylation of multiple genes in the upper aerodigestive tract epithelium of heavy smokers. Int J Cancer 2003;107:612–6.[CrossRef][ISI][Medline]

(21) Langenfeld J, Kiyokawa H, Sekula D, Boyle J, Dmitrovsky E. Posttranslational regulation of cyclin D1 by retinoic acid: a chemoprevention mechanism. Proc Natl Acad Sci U S A 1997;94:12070–4.[Abstract/Free Full Text]

(22) Boyle JO, Langenfeld J, Lonardo S, Sekula D, Reczek D, Rusch V, et al. Cyclin D1 proteolysis: a retinoid chemoprevention signal in normal, immortalized, and transformed human bronchial epithelial cells. J Natl Cancer Inst 1999;91:373–9.[Abstract/Free Full Text]

(23) Dragnev KH, Pitha-Rowe I, Ma Y, Petty WJ, Sekula D, Murphy B, et al. Specific chemopreventive agents trigger proteasomal degradation of G1 cyclins: implications for combination therapy. Clin Cancer Res 2004;10:2570–7.[Abstract/Free Full Text]

(24) Ma Y, Koza-Taylor PH, DiMattia DA, Hames L, Fu H, Dragnev KH, et al. Microarray analysis uncovers retinoid targets in human bronchial epithelial cells. Oncogene 2003;22:4924–32.[CrossRef][Medline]

(25) Petty WJ, Dragnev KH, Memoli V, Ma Y, Desai NB, Biddle A, et al. Epidermal growth factor receptor tyrosine kinase inhibition represses cyclin D1 in aerodigestive tract cancers. Clin Cancer Res 2004;10:7547–54.[Abstract/Free Full Text]

(26) Sirchia SM, Ren M, Pili R, Sironi E, Somenzi G, Ghidoni R, et al. Endogenous reactivation of the RAR{beta}2 tumor suppressor gene epigenetically silenced in breast cancer. Cancer Res 2002;62:2455–61.[Abstract/Free Full Text]

(27) Sommer KM, Chen LI, Treuting PM, Smith LT, Swisshelm K. Elevated retinoic acid receptor beta(4) protein in human breast tumor cells with nuclear and cytoplasmic localization. Proc Natl Acad U S A 1999;96:8651–6.[Abstract/Free Full Text]

(28) Peng X, Maruo T, Cao Y, Punj V, Mehta R, Gupta T, et al. A novel RARbeta isoform directed by a distinct promoter P3 and mediated by retinoic acid in breast cancer cells. Cancer Res 2004;64:8911–8.[Abstract/Free Full Text]

(29) Lantry LE, Zhang Z, Crist KA, Wang Y, Kelloff GJ, Lubert RA, et al. 5-Aza-2'-deoxycytidine is chemopreventive in a 4-(methyl-nitrosamino)-1-(3-pyridyl)-1-butanone-induced primary mouse lung tumor model. Carcinogenesis 1999;20:343–6.[Abstract/Free Full Text]

(30) Belinsky SA, Klinge DM, Stidley CA, Issa JF, Herman JG, March TH, et al. Inhibition of DNA methylation and histone deacetylation prevents murine lung cancer. Cancer Res 2003;63:7089–93.[Abstract/Free Full Text]

(31) Momparler RL, Ayoub J. Potential of 5-aza-2'-deoxycytidine (Decitabine) a potent inhibitor of DNA methylation for therapy of advanced non-small cell lung cancer. Lung Cancer 2001;Suppl 4:S111–5.

Manuscript received April 13, 2005; revised August 30, 2005; accepted September 23, 2005.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?

Editorial about this Article

RAR{beta}1': Primed To Fight Retinoid Resistance in Lung Carcinogenesis
Anita L. Sabichi, Xiaochun Xu, and Scott M. Lippman
J Natl Cancer Inst 2005 97: 1632-1633. [Extract] [Full Text] [PDF]



This article has been cited by other articles:


Home page
Clin. Cancer Res.Home page
K. H. Dragnev, W. J. Petty, S. J. Shah, L. D. Lewis, C. C. Black, V. Memoli, W. C. Nugent, T. Hermann, A. Negro-Vilar, J. R. Rigas, et al.
A Proof-of-Principle Clinical Trial of Bexarotene in Patients with Non-Small Cell Lung Cancer
Clin. Cancer Res., March 15, 2007; 13(6): 1794 - 1800.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. Huang, Z. D. Liang, T.-T. Wu, A. Hoque, H. Chen, Y. Jiang, H. Zhang, and X.-c. Xu
Tumor-Suppressive Effect of Retinoid Receptor-Induced Gene-1 (RRIG1) in Esophageal Cancer
Cancer Res., February 15, 2007; 67(4): 1589 - 1593.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
M. V. Karamouzis, P. A. Konstantinopoulos, and A. G. Papavassiliou
The Activator Protein-1 Transcription Factor in Respiratory Epithelium Carcinogenesis
Mol. Cancer Res., February 1, 2007; 5(2): 109 - 120.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
C. W. Xiao, J. Mei, W. Huang, C. Wood, M. R. L'Abbe, G. S. Gilani, G. M. Cooke, and I. H. Curran
Dietary Soy Protein Isolate Modifies Hepatic Retinoic Acid Receptor-{beta} Proteins and Inhibits Their DNA Binding Activity in Rats
J. Nutr., January 1, 2007; 137(1): 1 - 6.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
P. Germain, P. Chambon, G. Eichele, R. M. Evans, M. A. Lazar, M. Leid, A. R. De Lera, R. Lotan, D. J. Mangelsdorf, and H. Gronemeyer
International Union of Pharmacology. LX. Retinoic Acid Receptors
Pharmacol. Rev., December 1, 2006; 58(4): 712 - 725.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
S. J. Freemantle, K. H. Dragnev, and E. Dmitrovsky
The retinoic Acid paradox in cancer chemoprevention.
J Natl Cancer Inst, April 5, 2006; 98(7): 426 - 427.
[Full Text] [PDF]


Home page
aacredbookHome page
E. Dmitrovsky
D-Type Cyclins as Novel Targets for Chemoprevention
Am. Assoc. Cancer Res. Educ. Book, April 1, 2006; 2006(1): 59 - 63.
[Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
A. L. Sabichi, X. Xu, and S. M. Lippman
RAR{beta}1': Primed To Fight Retinoid Resistance in Lung Carcinogenesis
J Natl Cancer Inst, November 16, 2005; 97(22): 1632 - 1633.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (14)
Right arrow Request Permissions
Google Scholar
Right arrow Articles by Petty, W. J.
Right arrow Articles by Dmitrovsky, E.
Right arrow Search for Related Content