© 2005 Oxford University Press
ARTICLE |
A Novel Retinoic Acid Receptor
Isoform and Retinoid Resistance in Lung Carcinogenesis
Affiliations of authors: Department of Pharmacology and Toxicology (WJP, NL, AB, RB, YM, SJF, ED), Department of Medicine (WJP, KHD, ED), Norris Cotton Cancer Center (KHD, ED), Dartmouth College (CN), Hanover, NH
Correspondence to: W. Jeffrey Petty, MD, Internal MedicineHematology and Oncology, Wake Forest University School of Medicine, Medical Center Blvd., Winston-Salem, NC 27157 (e-mail: wpetty{at}wfubmc.edu).
| ABSTRACT |
|---|
|
|
|---|
Background: We previously reported that all-trans-retinoic acid (RA) treatment can prevent in vitro transformation of immortalized human bronchial epithelial (HBE) cells. Methods: To determine whether methylation inhibits RAR
expression in HBE cells, we used sodium bisulfite sequencing to compare RAR
P2 promoter methylation patterns in RA-sensitive (BEAS-2B) and RA-resistant (BEAS-2B-R1) HBE cells. Immunoblotting was used to assess induction of the RAR
, placental transforming growth factor
(PTGF-
), Fos-related antigen 1 (Fra-1), and transglutaminase II (TGase II) proteins by RA following treatment with azacitidine, a DNA demethylating agent. The expression, transcriptional activity, and growth suppressive activity of RAR
1', a novel RAR isoform, were evaluated in lung cancer cells transfected with RAR
1', and expression was also studied in paired normal lung tissues and lung tumors. All statistical tests were two-sided. Results: Hypermethylation was observed in the 3' region of the RAR
P2 promoter of BEAS-2B-R1 but not BEAS-2B cells. Azacitidine treatment of BEAS-2B-R1 cells restored RA-inducible RAR
2 and PTGF-
expression but not that of RAR
1', Fra-1, or TGase II. RAR
1' expression was repressed in RA-resistant BEAS-2B-R1 cells and in lung cancers, compared with adjacent normal lung tissues. BEAS-2B-R1 cells transiently transfected with RAR
1' had increased RA-dependent activation of a retinoic acid receptor element (RARE)containing reporter plasmid compared with vector control (mean = 3.2, 95% confidence interval [CI] = 3.1 to 3.3 versus mean = 1.4, 95% CI = 1.3 to 1.5; P<.001). In H358 lung cancer cells transiently transfected with RAR
1', RA treatment restored target gene expression compared with that in vector-transfected cells and suppressed cell growth compared with that in untreated cells (4 µM; treated mean = 0.49 versus untreated mean = 1.0, difference = 0.51, 95% CI = 0.35 to 0.67, P = .003; 8 µM: treated mean = 0.50 versus untreated mean = 1.0, difference = 0.50, 95% CI = 0.26 to 0.74, P = .015). Conclusion: Restoration of RAR
1' expression may overcome retinoid resistance in lung carcinogenesis.
| INTRODUCTION |
|---|
|
|
|---|
Vitamin A deficiency has been reported to cause preneoplastic changes in the bronchial epithelium and to be associated with an increased risk of lung cancer (1,2). Although results from initial clinical trials support a role for retinoids (natural and synthetic derivatives of vitamin A) in the chemoprevention of aerodigestive tract cancers (3,4), data from randomized trials suggest that carotenoids or retinoids are not effective for lung cancer chemoprevention in the general population, although a benefit may exist for nonsmokers (58). Clinical resistance to classical retinoids has been seen in lung cancer and is due, at least in part, to loss of retinoic acid receptors
(RAR
) expression during lung carcinogenesis (918). Loss of RAR
expression is often caused by genomic loss or epigenetic silencing due to genomic methylation or histone deacetylation (11,19). Hypermethylation of the RAR
promoter is an early event in lung carcinogenesis and is one of the most frequent methylation defects detected in the histopathologically normal bronchial epithelium of heavy smokers (20). However, whether loss of RAR
2 expression due to RAR
promoter methylation explains clinical resistance to RA is unknown.
We previously reported that all-trans-retinoic acid (RA) treatment can prevent in vitro transformation of immortalized human bronchial epithelial (HBE) cells and that this chemoprevention involves the proteasome-dependent degradation of G1 cyclins (21,22). In a later study, we derived an RA-resistant HBE cell line (BEAS-2B-R1) by selecting RA-sensitive (BEAS-2B) HBE cells with increasing concentrations of RA. Unlike parental BEAS-2B cells, BEAS-2B-R1 cells treated with RA do not degrade cyclin D1 or cyclin E or undergo G1 arrest (23). RA treatment does not induce RAR
or RA target gene expression in these cells (23,24).
In the present study, we used BEAS-2B-R1 RA-resistant HBE cells to investigate mechanisms responsible for RAR
silencing. We studied the methylation status of the RAR
P2 promoter, which is hypermethylated in certain lung cancer cells that lack RAR
2 expression (11). We then investigated whether treatment with the DNA demethylating agent azacitidine (also known as 5-azacytidine), alone or in combination with RA treatment, would restore RAR
expression and thereby induce the expression of previously identified retinoid target genes in BEAS-2B-R1 cells. Also, we investigated the structure, expression, and function of RAR
1', a previously unrecognized RAR
isoform, in lung cancer cells and in lung tumors and adjacent normal lung tissues.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell Culture
BEAS-2B and BEAS-2B-R1 cells were cultured in serum-free LHC-9 media in the dark at 37 °C with 5% CO2 in a humidified incubator as previously described (23,24). H358, H441, and A549 lung cancer cell lines and COS African green monkey kidney fibroblast cells were obtained and passaged as recommended by American Type Culture Collection (Manassas, VA). H358, H441, and COS cell lines were cultured in RPMI media containing L-glutamine and 10% fetal bovine serum (FBS) supplemented with 100 IU/mL of penicillin and 100 µg/mL of streptomycin. A549 cells were cultured in Ham's F12 media containing L-glutamine and 10% FBS supplemented with 100 IU/mL of penicillin and 100 µg/mL of streptomycin.
Compounds and Treatments
RA and trichostatin A (Sigma Chemicals, St. Louis, MO) were prepared as 10 mM stock solutions in dimethyl sulfoxide (DMSO) and stored in liquid nitrogen. Azacitidine was obtained from the National Cancer Institute (Bethesda, MD) and dissolved in phosphate-buffered saline, pH 6.3. Trichostatin A treatment was performed at a dosage of 200 nM for 48 hours. Azacitidine treatment was performed at a dosage of 1 µM for 48 hours.
Tumor Acquisition
Nonsmall-cell lung tumors and paired normal lung tissues were acquired as part of a Dartmouth-Hitchcock Medical Center Institutional Review Board (IRB)approved tumor acquisition protocol. The banked tissues do not carry patient identifiers and are exempt from IRB review under the Code of Federal Regulation Title 45, part 46.
Genomic DNA Methylation Sequencing
Genomic DNA was isolated from BEAS-2B and BEAS-2B-R1 cells using TRI Reagent (Molecular Research Center, Cincinnati, OH) per the manufacturer's protocol and was modified with sodium bisulfite, which converts unmethylated cytosine to uracil and amplified by polymerase chain reaction (PCR) using established techniques and primers that are specific for bisulfite-modified DNA: 5'-AAGTGAGTTGTTTAGAGGTAGGAGGG-3' (sense) and 5'-CCTATAATTAATCCA AATAATCATTTACC-3' (antisense) (11). PCR products were then independently ligated into the TOPO-TA cloning vector (Invitrogen, Carlsbad, CA) using the manufacturer's protocol, transfected into One Shot competent cells (Invitrogen) per the manufacturer's protocol, selected on ampicillin-containing agarose plates, and individually expanded for analyses. Eight independent clones from each reaction were sequenced using established techniques (25) to assess the methylation frequency of each CG doublet in the RAR
P2 promoter, which has been identified as hypermethylated in lung cancer cells that lack RAR
2 expression. The genomic sequence of the region studied (nucleotides +106 to +250) is as follows: 5'-CGAGAACGCGAGCGATCCGAG CAGGGTTTGTCTGGGCACCGTCGGGGTAGGATCCGGAACGCATTCGGAAGGCTTTTTGCAAGCATTTACTTGGAAGGAGAACTTGGGATCTTTCTGGGAACCCCCCGCCCCGGCTGGATTGGCC-3'.
Protein Extraction and Immunoblot Analysis
Immunoblot analyses of extracts from the described experiments were performed using previously optimized techniques (23). In brief, protein extracts were obtained by lysing cells in radioimmunoprecipitation assay buffer (10 mM Tris, 5 mM EDTA, 150 mM NaCl, 1% sodium deoxycholate, 1% Triton X-100, 0.1% sodium dodecyl sulfate, 1 mM NaF, and 1 mM sodium orthovanadate) followed by centrifugation at 10 000g for 15 minutes at 4 °C. The protein concentration of the supernatant was assayed using the Bradford method (Bio-Rad, Hercules, CA). Proteins were separated by sodium dodecyl sulfate10% polyacrylamide gel electrophoresis and electrophoretically transferred to nitrocellulose membranes for immunoblot analyses as previously described (23).
Primary antibodies to RAR
(rabbit polyclonal, 1 : 500), actin (goat polyclonal, 1 : 1000), placental transforming growth factor
(PTGF-
; goat polyclonal, 1 : 500), and Fos-related antigen 1 (Fra-1; rabbit polyclonal, 1 : 500) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). The transglutaminase II (TGase II; mouse monoclonal, 1 : 500) antibody was purchased from NeoMarkers (Fremont, CA). Species-appropriate mouse or rabbit (Amersham Biosciences Corporation, Piscataway, NJ) or goat (Santa Cruz Biotechnology) horseradish peroxidaseconjugated secondary antibodies were applied at a dilution of 1 : 3000 and binding was visualized using chemiluminescence (ECL Plus; Amersham Biosciences Corporation). Blocking peptide studies were performed for RAR
immunoblots of normal lung protein using a peptide specific to the C terminus of RAR
, per the manufacturer's protocol (Santa Cruz Biotechnology). The specificity of the RAR
1' band was confirmed by identifying the complete loss of the RAR
1' band in an immunoblot probed with the blocking peptide with the presence of the band in an immunoblot probed without blocking peptide performed simultaneously under otherwise identical conditions.
Reverse TranscriptionPCR Amplification of RAR
Isoforms
Total RNA was extracted from BEAS-2B cells, normal lung tissues, and malignant lung tissues using TRI Reagent (Molecular Research Center) per the manufacturer's protocol. RAR
isoforms were PCR amplified with cDNA generated from 1 µg of total RNA from each sample using the First-Strand cDNA synthesis system (Invitrogen) per the manufacturer's protocol. Annealing temperatures for the reactions were optimized for each primer pair. First-round amplification was performed for 35 cycles. Nested amplification was performed for 10 cycles using 5 µL of the first-round PCR product. Primers used to amplify RAR
isoforms were as follows: RAR
1, 5'-TGACGTCAGCAGTGACTACTG-3' (sense) and 5'-GTGGTTGAACTGCACATTCAGA-3' (antisense); RAR
2 and RAR
4, 5'-AACGCGAGCGATCCGAGCAG-3' (sense) and 5'-ATTTGTCCTGGCAGACGAAG CA-3' (antisense); and RAR
1', 5'-ATGAGGAATGAAGCTGAGTAGA-3' (sense) and 5'-ATTTGTCCTGGCAGACGAAGCA-3' (antisense) (26).
5' Rapid Amplification of cDNA Ends PCR
RACE-Ready cDNA from human lung was purchased from Invitrogen. Two primers complementary to the fourth exon of RAR
were designed for nested 5' rapid amplification of cDNA ends (5'-RACE) PCR amplification of RAR
isoforms: first-round primer 5'-ACTTGGTGG CCAGTTCACTGAATTTGT-3' and second-round primer 5'-CCTGGCAGACGAAGCAGGGTTTGTA-3'. RACE products were cloned using the TOPO-TA vector (Invitrogen) and were sequenced as described previously (25). One of the products identified was a novel RAR
isoform, designated RAR
1', which was registered as GenBank accession number DQ083391.
Luciferase Assay
The cloned products from the 5'-RACE PCR amplification were digested with EcoRI and XhoI restriction endonucleases (New England Biolabs, Beverly, MA) to release the exon 4 segment. An existing RAR
2-pSG5 construct containing the full length RAR
2 cDNA in the pSG5 expression vector was also digested with appropriate restriction endonucleases. The size-fractionated fragments were gel purified and the 5' portion of RAR
1' was ligated into a truncated 3' portion of the RAR
-pSG5 segment at exon 4 using T4 DNA ligase (Invitrogen) forming an RAR
1'-pSG5 expression construct. Sequencing was performed on separate clones to confirm the presence of the desired construct. COS kidney fibroblast cells and BEAS-2B-R1 cells were both cotransfected with the RAR
1' expression plasmid, the RAR
2 expression plasmid, or empty vector, and with a retinoic acid response elementthymidine kinase (RARE-TK) fusion gene construct containing a firefly luciferase reporter gene, and a TKRenilla luciferase reporter gene construct (as a control for transfection efficiency) using the FuGENE transfection system (Roche Diagnostics, Basel, Switzerland) according to the manufacturer's protocol. All transfections were performed in quadruplicate. BEAS-2B-R1 cells were cultured without exogenous RA for 7 days before transfection. Cells were then treated with RA at various doses or with vehicle (DMSO) for 3 hours. Luciferase activity was determined using the Dual Luciferase Reporter System (Promega, Madison, WI). Firefly luciferase measurements were normalized to Renilla luciferase measurements as a control for transfection efficiency.
RAR
1' Transfection and Proliferation Assays
To investigate the function of RAR
1', we cotransfected H358 lung cancer cells with a puromycin resistance expression vector (p-Pur, BD Biosciences, Mountain View, CA) and with either the RAR
1' expression vector or an insertless vector (pSG5). Cells were then treated with 2 µg/mL of puromycin for 24 hours to select against untransfected H358 cells. After 7 days, cells were plated in 96-well plates at a density of 3 x 103 cells per well for proliferation assays. Cellular proliferation was measured using the CellTiter-Glo assay kit (Promega). Assays were performed in triplicate. Basal luminescence activity and an ATP standard curve were each determined. Cells were then treated with either 4 µM of RA or with DMSO (vehicle) for 24 hours. Luminescence activity and an ATP standard curve were determined each day that the assay was performed. Growth rates were calculated by subtracting the basal ATP content from ATP content measured after RA or vehicle treatments, as described previously (25). Growth rates were normalized to that of vehicle-treated cells.
Statistical Methods
Differences between groups of continuous variables were assessed using the two-sample t test. P<.05 (two-sided) was considered statistically significant.
| RESULTS |
|---|
|
|
|---|
RAR
P2 Promoter Methylation and RA-Induced Expression of Target Genes
To determine the methylation status of the RAR
P2 promoter was different in RA-sensitive (BEAS-2B) and RA-resistant (BEAS-2B-R1) HBE cells, we assayed the CG-methylation pattern of the P2 promoter in each cell line using bisulfite modification and PCR sequencing. Independent determinations of the RAR
P2 promoter methylation pattern in BEAS-2B and BEAS-2B-R1 cells revealed that most CG doublets were methylated (in
50% of samples) in both cell lines. The CG doublets at the 3' region of this promoter were more frequently methylated in BEAS-2B-R1 than in BEAS-2B cells (Fig. 1).
|
We previously showed that BEAS-2B-R1 cells do not express RAR
after RA treatment, whereas BEAS-2B cells do. To determine if RA-inducible RAR
expression could be restored to BEAS-2B-R1 cells by demethylation, BEAS-2B-R1 cells were treated with azacitidine, a demethylating agent, or with trichostatin A, a histone deacetylase inhibitor. Pretreatment with 1 µM azacitidine for 48 hours restored RA-inducible RAR
expression (Fig. 2), whereas pretreatment with 200 nM trichostatin A for 48 hours did not (data not shown). A second RAR
immunoreactive protein that migrated at 47 kDa was identified in BEAS-2B cells but was repressed in BEAS-2B-R1 cells (Fig. 2). The expression of this protein was not induced by RA treatment, azacitidine treatment, or combined RA and azacitidine treatments. The expression of the other RAR
and RXR isoforms was similar in BEAS-2B-R1 and BEAS-2B cells (data not shown).
|
Protein expression of several RA target genes that were previously identified as being induced by RA in BEAS-2B cells but not in BEAS-2B-R1 cells were assessed after treatment with various combinations of RA and azacitidine or with vehicle. Azacitidine treatment restored the RA induction of PTGF
expression to BEAS-2B-R1 cells but not RA-inducible expression of TGase II or Fra-1 (Fig. 3).
|
Identification of a Novel RAR
Isoform
To identify the second RAR
protein repressed in BEAS-2B-R1 cells, we performed PCR analyses of RAR
1, RAR
2, and RAR
4 using published techniques (26). However, these RAR
isoforms were not amplified from BEAS-2B cDNA. To investigate the possible existence of a novel RAR
isoform, we performed 5' RACEPCR analysis using RNA derived from normal human lung tissue. The first round of PCR amplified several dominant species (Fig. 4, A), of which the largest species represented splice variants of RAR
2 and the smallest represented a novel isoform of RAR
present in normal human lung. Reverse transcriptionPCR analysis confirmed the expression of this isoform in BEAS-2B cells (data not shown). This isoform contains an upstream exon spliced into exon 3 of RAR
with an in-frame start codon. This previously unrecognized RAR
isoform was designated as RAR
1'. The genomic structure of this isoform is shown in Fig. 4, B.
|
Transient Transfection of BEAS-2B-R1 cells with RAR
1'
Translation of RAR
4 or RAR
5 arising from a downstream start codon produces a low-molecular-weight RAR
protein that inhibits RA-induced transactivation of an RARE-containing reporter construct (27,28). To determine whether the small novel RAR
1' also inhibits RA-inducible transactivation of RARE, we cotransfected BEAS-2B-R1 and COS cells with RAR
1', RAR
2, or empty vector and with a RARE-containing reporter gene construct. We then treated transfected cells with RA or DMSO (vehicle control). Cells transfected with RAR
1' or RAR
2 had higher RA-induced activation of the RARE reporter construct transfected cells (mean = 3.2, 95% confidence interval [CI] = 3.1 to 3.3, P<.001, and mean = 2.8, 95% CI = 2.6 to 3.0, P<.001, respectively) than vector-transfected cells (mean = 1.4, 95% CI = 1.3 to 1.5) (Fig. 5). A similar pattern of induction was observed in COS cells, although the basal reporter gene activity was not increased relative to vector transfectants in these cells, which were cultured without exogenous RA (data not shown), unlike BEAS-2B-R1 cells, which were grown in media supplemented with RA (23).
|
RAR
1' Expression in Lung Cancer Cell Lines and in Paired Normal and Malignant Lung Tissues
The relative expression of RAR
1' in lung cancers was sought using lung cancer cell lines as well as paired normal and malignant lung tissues. The RA response of several lung cancer cell lines was assessed by determining growth response following 4 µM RA treatment for 72 hours. The patterns of RAR
1' and RAR
2 expression in these cells, as determined by immunoblot analyses, were compared with those in RA-responsive BEAS-2B HBE cells. RAR
2 protein was abundantly expressed in A549 cells and barely detected in untreated H358 and H441 cells (Fig. 6, A). By contrast, RAR
1' protein expression was substantially lower in all three lung cancer cell lines than in BEAS-2B HBE cells (Fig. 6, A). Furthermore, when three sets of paired malignant and normal tissues were compared, RAR
1' protein expression in de novo lung cancers was consistently lower than that of normal lung tissues (Fig. 6, B). The identity of this protein was confirmed with a blocking peptide specific for the C terminus of RAR
(data not shown). Another set of paired malignant and normal lung tissue with available RNA was subjected to reverse transcriptionPCR analysis, from which RAR
1' RNA was detected in the normal lung tissue but not in the paired malignant tissue (data not shown).
|
Growth Suppression in RA-resistant Lung Cancer Cells Transfected with RAR
1'
We then studied the functional consequences of restoring RAR
1' expression in lung cancer cells. RA treatment slightly increased expression of RAR
2 and strongly increased that of the RA target gene PTGF-
in H358 cells (Fig. 7, A). To determine whether exogenous RAR
1' expression in RA-resistant cells would restore the growth-suppressive effects of RA treatment, we stably transfected H358 cells with either RAR
1'-pSG5 or an empty expression vector (pSG5) as a control. Transfected cells were then treated with RA or vehicle for 24 hours. RA treatment at 4 and 8 µM dosages had no effect on the growth of control cells (Fig. 7, B). In RAR
1' transfected cells, by contrast, RA treatment suppressed growth (4 µM: treated mean = 0.49 versus untreated mean = 1.0, difference = 0.51, 95% CI on the difference = 0.35 to 0.67, P = .003; 8 µM: treated mean = 0.50 versus untreated mean = 1.0, difference = 0.50, 95% CI on the difference = 0.26 to 0.74, P = .015; Fig. 7, B). Engineered expression of RAR
1' in H358 cells was also associated with restored RA induction of the RA target gene, TGase II (Fig. 7, C). By image quantification, TGase II expression was 2.4-fold greater in RA-treated RAR
1'-transfected cells than that in RA-treated control vector-transfected cells.
|
| DISCUSSION |
|---|
|
|
|---|
By investigating an RA-resistant HBE cell line BEAS-2B-R1 (derived by treating with increasing concentrations of RA), we have identified the existence of a novel RAR
isoform, RAR
1'. This isoform was expressed in normal lung and in RA-sensitive BEAS-2B cells but not in RA-resistant BEAS-2B-R1 cells, lung cancer cell lines, or clinical lung cancers. Transfection of this isoform into an RA-resistant lung cancer cell line, H358, that expresses low levels of RAR
2 conferred RA target gene induction and growth suppression following RA treatment. Thus, RAR
1' has distinct biologic properties compared with RAR
2 and appears to function as a tumor suppressor in lung carcinogenesis.
Repression of RAR
is often observed in lung carcinogenesis and likely confers resistance to the growth-suppressive effects of vitamin A and its derivatives (920). In this study, a specific domain of the RAR
P2 promoter was found to be hypermethylated in RA-resistant HBE cells that in turn led to RAR
silencing. This region of the P2 promoter appears to serve a key role in methylation-mediated silencing of RAR
in the lung. Consistent with this hypothesis, a murine model of tobacco-induced lung carcinogenesis highlighted a similar region of promoter methylation that conferred RAR
silencing (16).
In this study, we observed not only that RAR
2 and RAR
1' have distinct functions but also that their expression is regulated differentially. Although neither RAR
2 nor RAR
1' was expressed in RA-resistant BEAS-2B-R1 HBE cells, pretreatment with azacitidine restored only RA-dependent RAR
2 expression but not expression of RAR
1'. This increased RAR
2 expression was accompanied by increased expression of only one of the other RA target genes assayed, PTGF-
. Thus, we hypothesized that RAR
1' is required for the efficient induction of those RA target genes that were not restored by azacitidine treatment alone or by combined RA and azacitidine treatments. In support of this view, cotransfection of BEAS-2B-R1 cells with RAR
1' and an RA-responsive reporter gene enhanced retinoid trans-activation of the RARE reporter construct. Also, exogenous expression of RAR
1' in the H358 RA-resistant lung cancer cell line, which only slightly increases expression of RAR
2 following RA treatment, led to RA-dependent growth suppression and RA target gene induction, whereas no growth suppression was observed in H358 cells after RA treatment. These results strongly suggest that RAR
1' has a critical role in retinoid signaling in lung carcinogenesis. Furthermore, the observation that the expression of RAR
1' was repressed in BEAS-2B-R1 HBE and lung cancer cell lines and in lung cancer samples (but not in paired normal lung tissue) suggests that deregulation of this previously unrecognized RAR
isoform is important for conferring RA resistance. Restored expression of RAR
1' may only partially restore retinoid response. It is also possible that loss of RAR
1' expression will be necessary but not sufficient for conferring retinoid resistance. Further understanding of the role of RAR
1' in response to retinoids would be gained by selective knockdown of RAR
1'.
Azacitidine treatment of RA-resistant HBE cells conferred RA-dependent induction of RAR
2 expression and the activation of specific RA target genes. The results indicate that combining retinoids with a DNA demethylating agent might restore RAR
2 expression to lung cancer cells (11,2931). However, for an epigenetic targeting strategy to restore the full induction of RAR
target genes, the basis for RAR
1' repression needs to be determined. RAR
1' transcription is likely initiated by a distinct promoter near the first exon of this isoform. We did not find a classical RARE sequence in the promoter (data not shown), which is consistent with the inability of RA to induce RAR
1' expression (Fig. 2). Characterization of the RAR
1' promoter, regions of genomic DNA methylation, and histone acetylation changes within this region are the subject of future work. Combined treatment with a DNA demethylating agent and a histone deacetylase inhibitor might prove useful for restoring the expression and function of RAR
1'. For the success of this and other targeted approaches in lung cancer therapy, proof-of-principle studies are needed that confirm whether pharmacologic mechanisms identified in vitro are also engaged in the clinical setting (25). In this regard, studies to investigate the benefits of combining retinoids with chromatin-modifying drugs should evaluate changes in specific retinoid receptor isoforms as well as their target genes that would directly confer retinoid biologic effects (24).
This study is limited in part due to the number of cell lines studied. Future work will seek to extend our findings by investigating the effects of RAR
1' expression in more cancer cell lines. Restored expression of RAR
1' may restore retinoid sensitivity only in certain cell contexts. Furthermore, selective knockdown of RAR
1' will be necessary to determine whether loss of this species is sufficient to confer retinoid resistance.
Taken together, the data presented here directly implicate a critical role for RAR
1' in mediating retinoid biologic effects in the lung and perhaps other organ sites. RAR
1' itself could serve as a novel molecular pharmacologic target. The frequent repression of RAR
1' in lung carcinogenesis underscores its likely important biologic or clinical role. RAR
1' repression, despite RA treatment, offers a mechanistic explanation for clinical retinoid resistance that has been reported previously (7,8). Identification of pharmacologic approaches that restore RAR
1' expression would provide a basis for future retinoid-based combination strategies for lung cancer therapy or chemoprevention.
| NOTES |
|---|
|
|
|---|
Supported by the National Institutes of Health and National Cancer Institutes R01-CA87546 (E. Dmitrovsky), R01-CA62275 (E. Dmitrovsky), R01-CA111422 (E. Dmitrovsky), a Samuel Waxman Foundation Cancer Research Award (E. Dmitrovsky), and the Oracle Giving Fund (E. Dmitrovsky), as well as a CHEST Foundation of the American College of Chest Physicians and LUNGevity Foundation Clinical Research Award in Lung Cancer (W. J. Petty), an American Society of Clinical Oncology Young Investigator Award (W. J. Petty), and the National Institutes of Health grant T32-CA009658 (W. J. Petty).
We thank Dr. Christopher H. Lowrey (Dartmouth Medical School) for providing his expertise and assistance in the sodium bisulfite sequencing experiments.
W. J. Petty's former mailing address was Department of Pharmacology and Toxicology, Dartmouth Medical School, Dartmouth College, Hanover, NH 03755.
Funding to pay the Open Access publication charges for this article were provided by the Section on Hematology and Oncology, School of Medicine, Wake Forest University.
| REFERENCES |
|---|
|
|
|---|
(1) Sporn MB, Dunlop NM, Newton DL, Smith JM. Prevention of chemical carcinogenesis by vitamin A and its synthetic analogs (retinoids). Fed Proc 1976;35:13328.[ISI][Medline]
(2) Dogra SC, Khanduja KL, Gupta MP. The effect of vitamin A deficiency on the initiation and post-initiation phases of benzo(a)pyrene-induced lung tumorigenesis in rats. Br J Cancer 1985;52:9315.[Medline]
(3) Hong WK, Lippman SM, Itri LM, Karp DD, Lee JS, Byers RM, et al. Prevention of second primary tumors with isotretinoin in squamous-cell carcinoma of the head and neck. N Engl J Med 1990;323:795801.[Abstract]
(4) Pastorino U, Infante M, Maoli M, Chiesa G, Buyse M, Firket P, et al. Adjuvant treatment of stage I lung cancer with high-dose vitamin A. J Clin Oncol 1993;11:121622.
(5) The alpha-Tocopherol, beta-Carotene Cancer Prevention Study Group. The effect of vitamin E and beta carotene on the incidence of lung cancer and other cancers in male smokers. N Engl J Med 1994;330:102935.
(6) Hennikens CH, Buring JE, Manson GE, Stampfer M, Rosner B, Cook NR, et al. Lack of effect of long-term supplementation with beta carotene on the incidence of malignant neoplasms and cardiovascular disease. N Engl J Med 1996;334:11459.
(7) Omenn GS, Goodman GE, Thornquist ND, Balmes J, Cullen MR, Glass A, et al. Effects of the combination of beta carotene and vitamin A on lung cancer and cardiovascular disease. N Engl J Med 1996;334:11505.
(8) Lippman SM, Lee JJ, Karp DD, Vokes EE, Benner SE, Goodman GE, et al. Randomized Phase III intergroup trial of isotretinoin to prevent second primary tumors in stage I non-small cell lung cancer. J Natl Cancer Inst 2001;93:60518.
(9) Freemantle SJ, Spinella MJ, Dmitrovsky E. Retinoids in cancer therapy and chemoprevention: promise meets resistance. Oncogene 2003;22:730515.[CrossRef][ISI][Medline]
(10) Xu XC, Sozzi G, Lee JS, Lee JJ, Pastorino U, Pilotti S, et al. Suppression of retinoic acid receptor beta in non-small-cell lung cancer in vivo: implications for lung cancer development. J Natl Cancer Inst 1997;89:6249.
(11) Virmani AK, Rathi A, Zochbauer-Muller S, Sacchi N, Fukuyama Y, Bryant D, et al. Promoter methylation and silencing of the retinoic acid receptor-beta gene in lung carcinomas. J Natl Cancer Inst 2000;92:13037.
(12) Zhang XK, Liu Y, Lee MO, Pfahl M. A specific defect in the retinoic acid receptor associated with human lung cancer cell lines. Cancer Res 1994;54:56639.
(13) Xu XC, Ro JY, Lee JS, Shin DM, Hong WK, Lotan R. Differential expression of nuclear retinoid receptors in normal, premalignant, and malignant head and neck tissues. Cancer Res 1994;54:35807.
(14) Houle B, Rochette-Egly C, Bradley WE. Tumor-suppressive effect of the retinoic acid receptor beta in human epidermoid lung cancer cells. Proc Natl Acad Sci U S A 1993;90:9859.
(15) Lotan R, Xu XC, Lippman SM, Ro JR, Lee JS, Lee JJ, et al. Suppression of retinoic acid receptor-beta in premalignant oral lesion and its up-regulation by isotretinoin. N Engl J Med 1995;332:140510.
(16) Vuillemenot BR, Pulling LC, Palmisano WA, Hutt JA, Belinsky SA. Carcinogen exposure differentially modulates RAR-beta promoter hypermethylation, an early and frequent event in mouse lung carcinogenesis. Carcinogenesis 2004;25:6239.
(17) Youssef EM, Lotan D, Issa JP, Wakasa K, Fan YH, Mao L, et al. Hypermethylation of the retinoic acid receptor-beta(2) gene in head and neck carcinogenesis. Clin Cancer Res 2004;10:173342.
(18) Sun SY, Wan H, Yue P, Hong WK, Lotan R. Evidence that retinoic acid receptor beta induction by retinoids is important for tumor cell growth inhibition. J Biol Chem 2000;275:1714953.
(19) Suh YA, Lee HY, Virmani A, Wong J, Mann KK, Miller WH, et al. Loss of retinoic acid receptor beta gene expression is linked to aberrant histone H3 acetylation in lung cancer cell lines. Cancer Res 2002;62:39459.
(20) Zochbauer-Muller S, Lam S, Toyooka S, Virmani AK, Toyooka K, Seidl S, et al. Aberrant methylation of multiple genes in the upper aerodigestive tract epithelium of heavy smokers. Int J Cancer 2003;107:6126.[CrossRef][ISI][Medline]
(21) Langenfeld J, Kiyokawa H, Sekula D, Boyle J, Dmitrovsky E. Posttranslational regulation of cyclin D1 by retinoic acid: a chemoprevention mechanism. Proc Natl Acad Sci U S A 1997;94:120704.
(22) Boyle JO, Langenfeld J, Lonardo S, Sekula D, Reczek D, Rusch V, et al. Cyclin D1 proteolysis: a retinoid chemoprevention signal in normal, immortalized, and transformed human bronchial epithelial cells. J Natl Cancer Inst 1999;91:3739.
(23) Dragnev KH, Pitha-Rowe I, Ma Y, Petty WJ, Sekula D, Murphy B, et al. Specific chemopreventive agents trigger proteasomal degradation of G1 cyclins: implications for combination therapy. Clin Cancer Res 2004;10:25707.
(24) Ma Y, Koza-Taylor PH, DiMattia DA, Hames L, Fu H, Dragnev KH, et al. Microarray analysis uncovers retinoid targets in human bronchial epithelial cells. Oncogene 2003;22:492432.[CrossRef][Medline]
(25) Petty WJ, Dragnev KH, Memoli V, Ma Y, Desai NB, Biddle A, et al. Epidermal growth factor receptor tyrosine kinase inhibition represses cyclin D1 in aerodigestive tract cancers. Clin Cancer Res 2004;10:754754.
(26) Sirchia SM, Ren M, Pili R, Sironi E, Somenzi G, Ghidoni R, et al. Endogenous reactivation of the RAR
2 tumor suppressor gene epigenetically silenced in breast cancer. Cancer Res 2002;62:245561.
(27) Sommer KM, Chen LI, Treuting PM, Smith LT, Swisshelm K. Elevated retinoic acid receptor beta(4) protein in human breast tumor cells with nuclear and cytoplasmic localization. Proc Natl Acad U S A 1999;96:86516.
(28) Peng X, Maruo T, Cao Y, Punj V, Mehta R, Gupta T, et al. A novel RARbeta isoform directed by a distinct promoter P3 and mediated by retinoic acid in breast cancer cells. Cancer Res 2004;64:89118.
(29) Lantry LE, Zhang Z, Crist KA, Wang Y, Kelloff GJ, Lubert RA, et al. 5-Aza-2'-deoxycytidine is chemopreventive in a 4-(methyl-nitrosamino)-1-(3-pyridyl)-1-butanone-induced primary mouse lung tumor model. Carcinogenesis 1999;20:3436.
(30) Belinsky SA, Klinge DM, Stidley CA, Issa JF, Herman JG, March TH, et al. Inhibition of DNA methylation and histone deacetylation prevents murine lung cancer. Cancer Res 2003;63:708993.
(31) Momparler RL, Ayoub J. Potential of 5-aza-2'-deoxycytidine (Decitabine) a potent inhibitor of DNA methylation for therapy of advanced non-small cell lung cancer. Lung Cancer 2001;Suppl 4:S1115.
Manuscript received April 13, 2005; revised August 30, 2005; accepted September 23, 2005.
Editorial about this Article
![]()
CiteULike
Connotea
Del.icio.us What's this?
1': Primed To Fight Retinoid Resistance in Lung Carcinogenesis
J Natl Cancer Inst 2005 97: 1632-1633.
This article has been cited by other articles:
![]() |
K. H. Dragnev, W. J. Petty, S. J. Shah, L. D. Lewis, C. C. Black, V. Memoli, W. C. Nugent, T. Hermann, A. Negro-Vilar, J. R. Rigas, et al. A Proof-of-Principle Clinical Trial of Bexarotene in Patients with Non-Small Cell Lung Cancer Clin. Cancer Res., March 15, 2007; 13(6): 1794 - 1800. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Huang, Z. D. Liang, T.-T. Wu, A. Hoque, H. Chen, Y. Jiang, H. Zhang, and X.-c. Xu Tumor-Suppressive Effect of Retinoid Receptor-Induced Gene-1 (RRIG1) in Esophageal Cancer Cancer Res., February 15, 2007; 67(4): 1589 - 1593. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. V. Karamouzis, P. A. Konstantinopoulos, and A. G. Papavassiliou The Activator Protein-1 Transcription Factor in Respiratory Epithelium Carcinogenesis Mol. Cancer Res., February 1, 2007; 5(2): 109 - 120. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. W. Xiao, J. Mei, W. Huang, C. Wood, M. R. L'Abbe, G. S. Gilani, G. M. Cooke, and I. H. Curran Dietary Soy Protein Isolate Modifies Hepatic Retinoic Acid Receptor-{beta} Proteins and Inhibits Their DNA Binding Activity in Rats J. Nutr., January 1, 2007; 137(1): 1 - 6. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Germain, P. Chambon, G. Eichele, R. M. Evans, M. A. Lazar, M. Leid, A. R. De Lera, R. Lotan, D. J. Mangelsdorf, and H. Gronemeyer International Union of Pharmacology. LX. Retinoic Acid Receptors Pharmacol. Rev., December 1, 2006; 58(4): 712 - 725. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Freemantle, K. H. Dragnev, and E. Dmitrovsky The retinoic Acid paradox in cancer chemoprevention. J Natl Cancer Inst, April 5, 2006; 98(7): 426 - 427. [Full Text] [PDF] |
||||
![]() |
E. Dmitrovsky D-Type Cyclins as Novel Targets for Chemoprevention Am. Assoc. Cancer Res. Educ. Book, April 1, 2006; 2006(1): 59 - 63. [Full Text] [PDF] |
||||
![]() |
A. L. Sabichi, X. Xu, and S. M. Lippman RAR{beta}1': Primed To Fight Retinoid Resistance in Lung Carcinogenesis J Natl Cancer Inst, November 16, 2005; 97(22): 1632 - 1633. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||







, P = .015 as determined by two-sided t test. C) H358 cells were transiently transfected with either RAR





