Skip Navigation

JNCI Journal of the National Cancer Institute 2005 97(14):1089-1090; doi:10.1093/jnci/dji119
This Article
Right arrow Extract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (1)
Right arrow Request Permissions
Google Scholar
Right arrow Articles by Vargas, R. L.
Right arrow Articles by Rothberg, P. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vargas, R. L.
Right arrow Articles by Rothberg, P. G.
Related Collections
Right arrowResponse to this Correspondence
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© 2005 Oxford University Press

CORRESPONDENCE

Re: Prognostic Significance of a Short Sequence Insertion in the MCL-1 Promoter in Chronic Lymphocytic Leukemia

Roberto L. Vargas, Raymond E. Felgar, Paul G. Rothberg

Affiliation of authors: Department of Pathology and Laboratory Medicine, University of Rochester Medical Center, Rochester, NY

Correspondence to: Paul G. Rothberg, PhD, Department of Pathology and Laboratory Medicine, 601 Elmwood Ave., Box 626, Rochester, NY 14642 (e-mail: Paul_Rothberg{at}urmc.rochester.edu).

We read with interest the report of Moshynska et al. (1) on the discovery of two different insertional mutations at the same position in the promoter of the MCL-1 gene in chronic lymphocytic leukemia (CLL) specimens. The insertions, of 6 or 18 nucleotides, were associated with increased expression of MCL-1 mRNA and protein and with a poorer prognosis for the patients. In preparation for the development of a rapid and focused assay for these mutations, we searched the DNA sequence database at the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=Nucleotide) for genomic sequences of the MCL-1 gene. The sequence described by Moshynska et al. as being wild type was found in accession numbers AF162676 and AF198614. However, the 18-bp insertion was the sequence of record in accession numbers AL356356 and AF147742.

We therefore considered the possibility that the mutations discovered by Moshynska et al. (1) exist as germline variants. The assay we devised involves polymerase chain reaction (PCR) and polyacrylamide gel electrophoresis. We searched for the mutations/polymorphisms in 24 individuals using anonymized DNAs from the peripheral blood of people who had been tested for genetic disease and had not been selected with regard to the presence or absence of malignancy. We found clear evidence for the existence of at least three size variants in this region. Figure 1 shows an example of such an analysis. Lane 1 contains a DNA fragment that was confirmed by sequence analysis (data not shown) to have the same sequence as the wild-type allele in Fig. 1 of Moshynska et al. (1). Lane 2 shows a clear separation of a larger form, and lane 3 reveals heteroduplex bands consistent with a polymorphism that did not resolve by gel electrophoresis. Sequence analysis of the DNA fragments generated by the PCR shown in lane 3 revealed two overlapping sequences, one consistent with the wild-type allele and the other corresponding to the 6-bp insertion described by Moshynska et al. (1) (data not shown). A similar analysis of a specimen with the larger DNA fragment such as that seen in lane 2 revealed the presence of two overlapping sequences, the wild-type sequence and the 18-bp insertion (1) (data not shown). These data strongly suggest that the different forms of the MCL-1 promoter reported by Moshynska et al. (1) exist as germline polymorphisms. We did not study a sufficient number of specimens to establish an allele frequency for the variant forms; however, each variant was detected more than once.



View larger version (40K):
[in this window]
[in a new window]
 
Fig. 1. Polymerase chain reaction (PCR) analysis of the MCL-1 gene promoter region. Genomic DNA was amplified using PCR. The PCR was done in a volume of 25 µL, with the primers (upstream primer, CGTTACGTAACCGGCACTCAGA; downstream primer, CGGCAGCTTCCGGAGGGTTG) at a concentration of 1 µM each, 50 µM each deoxynucleoside triphosphate, and 1.2 units of HotStar Taq DNA polymerase in the buffer provided by the manufacturer of the enzyme (Qiagen Inc., Valencia, CA). The tubes were subjected to 34 cycles of 96°C for 20 seconds, 58°C for 30 seconds, and 72°C for 1 minute, preceded by 95°C for 10 minutes, and followed by 72°C for 5 minutes, in an Eppendorf Mastercycler (Brinkmann Instruments, Westbury, NY). The PCR products were separated by polyacrylamide gel electrophoresis, stained with ethidium bromide, and photographed. Lane 1 has only the wild-type sequence. Lane 2 is heterozygous for the 18-bp insertion, with clear separation of the two bands. Lane 3 is heterozygous for the 6-bp insertion. Although the DNA fragments in this lane did not clearly separate from each other, the presence of the two forms is demonstrated by the formation of the heteroduplex bands and was confirmed by DNA sequence analysis (data not shown). M = size markers (size indicated in base pairs [bp]). The region of the gel containing heteroduplexes is indicated.

 
Despite our finding that the DNA variants identified by Moshynska et al. (1) exist as germline polymorphisms, our data do not challenge their interesting finding of tumor-specific alterations in CLL patients or the association of the variants with the course of the disease. In fact, the association of the MCL-1 variants with increased expression of MCL-1 RNA and protein (1) and the role of MCL-1 in apoptosis (2) raise additional questions concerning the possible role of the MCL-1 germline variants as genetic modifiers of the risk of malignancy.

REFERENCES

(1) Moshynska O, Sankaran K, Pahwa P, Saxena A. Prognostic significance of a short sequence insertion in the MCL-1 promoter in chronic lymphocytic leukemia. J Natl Cancer Inst 2004;96:673–82.[Abstract/Free Full Text]

(2) Zhou P, Qian L, Kozopas KM, Craig RW. Mcl-1, a Bcl-2 family member, delays the death of hematopoietic cells under a variety of apoptosis-inducing conditions. Blood 1997;89:630–43.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?

Response to this Correspondence

RESPONSE: Re: Prognostic Significance of a Short Sequence Insertion in the MCL-1 Promoter in Chronic Lymphocytic Leukemia
Oksana Moshynska and Anurag Saxena
J Natl Cancer Inst 2005 97: 1093-1095. [Extract] [Full Text] [PDF]




This Article
Right arrow Extract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (1)
Right arrow Request Permissions
Google Scholar
Right arrow Articles by Vargas, R. L.
Right arrow Articles by Rothberg, P. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vargas, R. L.
Right arrow Articles by Rothberg, P. G.
Related Collections
Right arrowResponse to this Correspondence
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?