© 2005 Oxford University Press
BRIEF COMMUNICATION |
High Frequency of Somatic Frameshift BHD Gene Mutations in Birt-Hogg-DubéAssociated Renal Tumors
Affiliations of authors: Urologic Oncology Branch (CDV, YY, CPP, CATC, MMW, WML), and Laboratory of Pathology (CATC, MJM), Center for Cancer Research, National Cancer Institute, Bethesda, MD; Basic Research Program, SAICFrederick, Inc. (LSS), and Laboratory of Immunobiology, National Cancer Institute, Frederick, MD (MLN, BZ)
Correspondence to: Cathy D. Vocke, PhD, Urologic Oncology Branch, Bldg. 10, CRC, Rm. 1W-5888, National Cancer Institute, Bethesda, MD 20892 (e-mail: vockec{at}mail.nih.gov).
| ABSTRACT |
|---|
|
|
|---|
The Birt-Hogg-Dubé (BHD) syndrome is an inherited genodermatosis characterized by a predisposition to hamartomatous skin lesions, pulmonary cysts, and renal carcinoma. Seventy-seven renal tumors from 12 patients with germline BHD mutations were examined by DNA sequencing to identify somatic mutations in the second copy of BHD. Sequence alterations were detected in the majority of renal tumors (41 of 77, 53%), with loss of heterozygosity at the BHD locus in a minority of additional tumors (14 of 77, 17%). The somatic mutations were distributed across the entire gene, and the majority resulted in frameshifts that are predicted to truncate the BHD protein. These results support a role for BHD as a tumor suppressor gene that predisposes to the development of renal tumors when both copies are inactivated.
A small percentage of renal cell carcinomas (RCCs), which are subclassified by histology into clear-cell (75% of cases), papillary (10%15%), and chromophobe (5%) RCCs and renal oncocytoma (3%5%), are due to inherited cancer syndromes (1,2). Each inherited cancer syndrome, such as von Hippel-Lindau (VHL), hereditary papillary cell carcinoma (HPRC), and hereditary leiomyomatosis and renal cell carcinoma (HLRCC), is characterized by the development of specific histologic types of renal cancer (3,4). For example, affected members of families with VHL syndrome frequently develop clear-cell RCCs, whereas patients with HPRC are predisposed to develop type 1 papillary renal carcinomas (5,6). Patients with HLRCC, by contrast, develop aggressive papillary type 2 renal carcinomas (79).
Recently, individuals with Birt-Hogg-Dubé syndrome (BHD), a genodermatosis characterized by fibrofolliculomas (hamartomas of the hair follicle) (10) and pulmonary cysts (11,12), were found to have a seven-fold higher risk over the general population of developing kidney neoplasms (13). Unlike renal tumors in patients with other inherited kidney cancer syndromes, renal tumors from BHD patients exhibit a spectrum of histologic types, including chromophobe (34%), oncocytoma (5%), clear cell (9%), papillary (2%), and an oncocytic hybrid (50%) with features of chromophobe RCC and renal oncocytoma (1416). Germline mutations have been identified in a novel gene, BHD, in affected family members (17). BHD encodes a protein, folliculin, which is named for the hallmark dermatologic lesions found in BHD patients. All germline mutations identified to date are frameshift or nonsense mutations that are predicted to truncate folliculin, including insertions or deletions of a tract of eight cytosines (C8) in exon 11 (17,18). Mutations in this "hot spot" are found in the germline of 44% of BHD patients (17). The high frequency of germline-inactivating mutations suggests that BHD may act as a tumor suppressor gene. Identifying a somatic "second hit" in the copy of BHD without a germline mutation would support a tumor suppressor function for BHD according to the Knudson two-hit hypothesis.
To address the mutation status of the BHD gene in tumors from Birt-Hogg-Dubé patients, we analyzed a panel of 77 renal tumors by direct DNA sequence analysis. Tumor samples, as well as matched normal samples, were obtained from 12 affected members of BHD families after renal surgery at the National Cancer Institute (NCI). The protocol was approved by the institutional review board of NCI, and the patients gave written informed consent.
BHD patients were often found to have bilateral, multifocal tumors and underwent staged bilateral partial nephrectomies, providing tumor samples for this study. Out of 77 tumors, 45 frozen tumor samples were sectioned and microdissected manually to obtain both tumor and histologically normal tissue. DNA was isolated in a solution containing 10 mM Tris-HCl (pH 8.0), 1 mM EDTA, 1% Tween 20, and 0.1 mg/mL proteinase K as described (19). For the remaining 32 tumors, tissue was no longer available for microdissection, and DNA was obtained from bulk extraction of tissue under high-salt conditions (Puregene kit, Gentra Systems, Minneapolis, MN).
The entire coding region of BHD (exons 414) was sequenced in each tumor sample, following polymerase chain reaction (PCR) amplification. PCR was carried out using genomic primers for the BHD gene as previously described (17). A modified primer, SKA31, with the sequence TTCCTGCCGGTTTTGAAGGTG, was substituted for primer SKA3 because it produced more reliable amplification. Reactions were carried out in a 25 µL volume using Taq PCR Master Mix (Qiagen, Valencia, CA), 0.4 µM concentrations of each primer, and a volume of input tumor DNA that was empirically determined to result in sufficient product under standard PCR conditions. Sequencing was carried out using Big Dye Terminator chemistry and run on an ABI Prism 310 Genetic Analyzer (PE/Applied Biosystems, Foster City, CA). Each mutation was verified by repeat PCR and sequencing. To confirm a somatic BHD mutation in a tumor sample independent of the second gene copy, PCR amplicons that contained a somatic BHD mutation were cloned into the TOPO TA cloning vector or the TOPO XL cloning vector (Invitrogen, Carlsbad, CA) and characterized by sequencing as described above.
The known germline mutation from each patient was detected in every tumor. In addition, either a somatic mutation or loss of heterozygosity (LOH) was detected in at least one of the tumors in all 12 BHD patients. In total, 54 of 77 (70%) of their tumors were found to have a somatic mutation or LOH, and, at most, only a single alteration was found in each tumor (Table 1; Fig. 1). In contrast, no somatic mutations were found in any matched normal DNA. The somatic mutations that were observed in 41 of 77 (53%) tumors were distributed throughout the BHD coding region, and the majority (30 of 41, 75%) of somatic mutations were frameshift mutations within the open reading frame. Three nonsense mutations were also identified, one in exon 12 and two in exon 14. Interestingly, no missense mutations were detected in this tumor panel.
|
|
In addition to the somatic mutations observed in 41 BHD tumors, LOH was identified at the site of the germline mutation or at an observed single nucleotide polymorphism (SNP) in 13 of 77 (17%) tumors (Table 1; Fig. 1). In every case of LOH, the germline mutation was retained, and the wild-type sequence was lost. Interestingly, one of patient 2's tumors appeared to have a partial deletion of the gene, because it exhibited LOH at the germline mutation in exon 9 but not at a SNP in intron 12 (Table 1). In all, the frequency of a second hit (LOH or a somatic mutation) in the BHD gene was greater than 50%. Together, these results indicate that renal tumors associated with the BHD syndrome arise from cells in which both copies of the BHD gene are inactivated, supporting the hypothesis that BHD is a tumor suppressor gene.
For BHD to fit the model of a tumor suppressor gene, the second mutation must occur on the wild-type copy of BHD. Although mutation analysis of discrete genomic regions that are amplified by PCR is unable to distinguish between the allele with a germline mutation and the other allele except when the somatic mutation occurs in the same exon as the germline mutation, we observed germline and somatic BHD mutations occurring in the same exon in six of 41 tumors. PCR-amplified products from these exons were subcloned, permitting the identification and sequencing of both BHD alleles. We confirmed that two BHD mutations, one on each allele, had occurred in these renal tumors (Fig. 1). These data, combined with the apparent loss of the wild-type allele in 13 tumors, indicate that the first and second mutations occur on different copies of the BHD gene.
However, not all tumors exhibited LOH or somatic mutations. No LOH or somatic mutations were detected in 23 of 77 tumors (30%). In such cases, gene silencing by hypermethylation or mutations in regulatory regions of the BHD gene may play a role in its inactivation. Alternatively, normal cell contamination of tumor tissue may have interfered with detection of somatic mutations in some cases.
In our study, the frequency of somatic mutations and LOH seen differed slightly by renal tumor histology. Whereas 78% of chromophobe tumors (13 mutations plus five LOH in 23 tumors), 72% (27 mutations and seven LOH in 47 tumors) of oncocytic hybrid tumors, and 50% (three mutations and one LOH in eight tumors) of oncocytomas had second hits, no second hit was detected in either of the two clear-cell tumors. It is unclear whether these differences in mutation and LOH frequencies are due to sampling bias, association of a second hit with histologic type, or differences in the degree of normal cell contamination in these histologic types.
Our data showed that the tumors from a given BHD patient have different second hits. A schematic depiction of kidney lesions from a typical BHD patient with mutations superimposed is shown in Figure 2. Distinct somatic mutations or LOH were observed in the 15 lesions. This patient also developed several renal tumors with mixed histologic features. Again, LOH and mutation analysis were performed on tissue from the different histologic areas of three such tumors. Within each tumor, the same second hit was observed, regardless of histology. These observations strongly suggest that multiple renal tumors from some BHD patients are independent, clonal events, each arising from a separate and unique second mutation in the BHD gene. However, the three tumors with mixed histologies shared a common somatic mutation in the distinct histologic regions within each tumor. This finding suggests that in some cases, a somatic second hit precedes histologic diversification within a single tumor. The molecular mechanism that drives these events is unknown.
|
Interestingly, somatic mutations as the second hit were more common than LOH in BHD tumors. A similar phenomenon is observed in the adenomatous polyposis coli (APC) tumor suppressor gene. The location of the germline APC mutation is thought to influence the type of second hit that occurs (20). It has been hypothesized that the combination of first and second hits controls and directs an optimal level of
-catenin activity, referred to as the "just right" or "loose fit" model (21,22). To date, there appears to be no relationship between the location of the BHD germline mutation and the nature of the second hit (Table 1). However, tumors with a wider variety of germline mutations should be examined to resolve this question. In conclusion, this report is the first comprehensive evaluation of a large number of renal tumors from BHD patients with a known germline BHD mutation. Our results document the high frequency and wide spectrum of second mutations, which strongly support a tumor suppressor role for BHD. Inactivation of both copies of BHD occurred in several histologic types of renal tumors, suggesting that BHD may act at an early stage of renal oncogenesis. Further understanding of the mechanism of BHD-induced tumorigenesis awaits functional studies of the folliculin protein.
| NOTES |
|---|
|
|
|---|
Present address: Christian P. Pavlovich, Johns Hopkins University, Department of Urology, Baltimore, MD.
This publication has been funded in part with federal funds from the National Cancer Institute, National Institutes of Health, under contract N01-C0-12400. The content of this publication does not necessarily reflect the views or policies of the Department of Health and Human Services, nor does mention of trade names, commercial products, or organizations imply endorsement by the U.S. Government.
We thank the BHD patients and their families for their cooperation.
| REFERENCES |
|---|
|
|
|---|
(1) Kovacs G, Akhtar M, Beckwith BJ, Bujert P, Cooper CS, Delahunt B, et al. The Heidelberg classification of renal cell tumors. J Pathol 1997;183:1313.[CrossRef][Web of Science][Medline]
(2) Storkel S, Eble JN, Adlakha K, Amin M, Blute ML, Bostwick DG, et al. Classification of renal cell carcinoma: Workgroup No. 1. Union Internationale Contre le Cancer (UICC) and the American Joint Committee on Cancer (AJCC). Cancer 1997;80:9879.[CrossRef][Web of Science][Medline]
(3) Linehan WM, Walther MM, Zbar B. The genetic basis of cancer of the kidney. J Urol 2003;170:216372.[CrossRef][Web of Science][Medline]
(4) Pavlovich CP, Schmidt LS, Phillips JL. The genetic basis of renal cell carcinoma. Urol Clin North Am 2003;30:43754, vii.[CrossRef][Web of Science][Medline]
(5) Schmidt L, Duh F-M, Chen F, Kishida T, Glenn G, Choyke P, et al. Germline and somatic mutations in the tyrosine kinase domain of the MET proto-oncogene in papillary renal carcinomas. Nat Genet 1997;16:6873.[CrossRef][Web of Science][Medline]
(6) Schmidt L, Junker K, Kinjerski T, Weirich G, Neumann H, Brauch H, et al. Novel mutations of the MET proto-oncogene in papillary renal carcinomas. Oncogene 1999;18:234350.[CrossRef][Web of Science][Medline]
(7) Launonen V, Vierimaa O, Kiuru M, Isola J, Roth S, Pukkala E, et al. Inherited susceptibility to uterine leiomyomas and renal cell cancer. Proc Natl Acad Sci U S A 2001;98:338792.
(8) Tomlinson IP, Alam NA, Rowan AJ, Barclay E, Jaeger EE, Kelsell D, et al. Germline mutations in FH predispose to dominantly inherited uterine fibroids, skin leiomyomata and papillary renal cell cancer. Nat Genet 2002;30:40610.[CrossRef][Web of Science][Medline]
(9) Toro JR, Nickerson ML, Wei MH, Warren MB, Glenn GM, Turner ML, et al. Mutations in the fumarate hydratase gene cause hereditary leiomyomatosis and renal cell cancer in families in North America. Am J Hum Genet 2003;73:95106.[CrossRef][Web of Science][Medline]
(10) Birt AR, Hogg GR, Dube WJ. Hereditary multiple fibrofolliculomas with trichodiscomas and acrochordons. Arch Dermatol 1977;113:167477.
(11) Binet O, Robin J, Vicart M, Ventura G, Beltzer-Garelly E. Fibromes perifolliculaires polypose colique familaile pneumothorax spontanes familiaux. Ann Dermatol Venereol 1986;113:92830.[Web of Science]
(12) Toro J, Duray PH, Glenn GM, Darling T, Zbar B, Linehan WM, et al. Birt-Hogg-Dube syndrome: a novel marker of kidney neoplasia. Arch Dermatol 1999;135:11951202.
(13) Zbar B, Alvord G, Glenn G, Turner M, Pavlovich CP, Schmidt LS, et al. Risk of renal and colon neoplasms and spontaneous pneumothorax in the Birt Hogg Dube syndrome. Cancer Epidemiol Biomarkers Prev 2002;11:393400.
(14) Pavlovich CP, Hewitt S, Walther MM, Eyler RA, Zbar B, Linehan WM, et al. Renal tumors in the Birt-Hogg-Dube syndrome. Am J Surg Pathol 2002;26:154252.[CrossRef][Web of Science][Medline]
(15) Tickoo SK, Reuter VE, Amin MB, Srigley JR, Epstein JI, Min KW. Renal oncocytosis: a morphologic study of fourteen cases. Am J Surg Pathol 1999;23:1094101.[CrossRef][Web of Science][Medline]
(16) Schmidt LS, Warren MB, Nickerson ML, Weirich G, Matrosova V, Toro JR, et al. Birt Hogg Dube syndrome, a genodermatosis associated with spontaneous pneumothorax and kidney neoplasia, maps to chromosome 17p11.2. Am J Hum Genet 2001;69:87682.[CrossRef][Web of Science][Medline]
(17) Nickerson ML, Warren MB, Toro JR, Matrosova V, Glenn G, Turner ML, et al. Mutations in a novel gene lead to kidney tumors, lung wall defects, and benign tumors of the hair follicle in patients with the Birt-Hogg-Dube syndrome. Cancer Cell 2002;2:15764.[CrossRef][Web of Science][Medline]
(18) Khoo SK, Giraud S, Kahnoski K, Chen J, Motorna O, Nickolov R, et al. Clinical and genetic studies of Birt-Hogg-Dube syndrome. J Med Genet 2002;39:90612.
(19) Zhuang Z, Bertheau P, Emmert-Buck MR, Liotta LA, Gnarra JR, Linehan WM, et al. A microdissection technique for archival DNA analysis of specific cell populations in lesions <1 mm in size. Am J Pathol 1995;146:6205.[Abstract]
(20) Lamlum H, Ilyas M, Rowan A, Clark S, Johnson V, Bell J, et al. The type of somatic mutation at APC in familial adenomatous polyposis is determined by the site of the germline mutation: a new facet to Knudson's two-hit hypothesis. Nat Med 1999;5:107175.[CrossRef][Web of Science][Medline]
(21) Albuquerque C, Breukel C, van der Luijt R, Fidalgo P, Lage P, Slors FJ, et al. The just-right signaling model: APC somatic mutations are selected based on a specific level of activation of the beta-catenin signaling cascade. Hum Mol Genet 2002;11:154960.
(22) Crabtree M, Sieber OM, Lipton L, Hodgson SV, Lamlum H, Thomas HJ, et al. Refining the relation between first hits and second hits at the APC locus: the loose fit model and evidence for differences in somatic mutation spectra among patients. Oncogene 2003;22:425765.[CrossRef][Web of Science][Medline]
(23) Khoo SK, Kahnoski K, Sugimura J, Petillo D, Chen J, Shockley K, et al. Inactivation of BHD in sporadic renal tumors. Cancer Res 2003;63:45837.
(24) da Silva NF, Gentle D, Hesson LB, Morton DG, Latif F, Maher ER. Analysis of the Birt-Hogg-Dube (BHD) tumour suppressor gene in sporadic renal cell carcinoma and colorectal cancer. J Med Genet 2003;40:8204.
(25) Kahnoski K, Khoo SK, Nassif NT, Chen J, Lobo GP, Segelov E, et al. Alterations of the Birt-Hogg-Dube gene (BHD) in sporadic colorectal tumours. J Med Genet 2003;40:5115.
(26) Antonarakis SE. Recommendations for a nomenclature system for human gene mutations. Nomenclature Working Group. Hum Mutat 1998;11:13.[CrossRef][Web of Science][Medline]
Manuscript received November 23, 2004; revised March 31, 2005; accepted April 26, 2005.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
Y. Hasumi, M. Baba, R. Ajima, H. Hasumi, V. A. Valera, M. E. Klein, D. C. Haines, M. J. Merino, S.-B. Hong, T. P. Yamaguchi, et al. Homozygous loss of BHD causes early embryonic lethality and kidney tumor development with activation of mTORC1 and mTORC2 PNAS, November 3, 2009; 106(44): 18722 - 18727. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. M. Linehan Genetic Basis of Bilateral Renal Cancer: Implications for Evaluation and Management J. Clin. Oncol., August 10, 2009; 27(23): 3731 - 3733. [Full Text] [PDF] |
||||
![]() |
D. W. Gardiner and T. R. Spraker Generalized Nodular Dermatofibrosis in the Absence of Renal Neoplasia in an Australian Cattle Dog Veterinary Pathology, November 1, 2008; 45(6): 901 - 904. [Abstract] [Full Text] [PDF] |
||||
![]() |
J R Toro, M-H Wei, G M Glenn, M Weinreich, O Toure, C Vocke, M Turner, P Choyke, M J Merino, P A Pinto, et al. BHD mutations, clinical and molecular genetic investigations of Birt-Hogg-Dube syndrome: a new series of 50 families and a review of published reports J. Med. Genet., June 1, 2008; 45(6): 321 - 331. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Mayr, D. Meierhofer, F. Zimmermann, R. Feichtinger, C. Kogler, M. Ratschek, N. Schmeller, W. Sperl, and B. Kofler Loss of Complex I due to Mitochondrial DNA Mutations in Renal Oncocytoma Clin. Cancer Res., April 15, 2008; 14(8): 2270 - 2275. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Baba, M. Furihata, S.-B. Hong, L. Tessarollo, D. C. Haines, E. Southon, V. Patel, P. Igarashi, W. G. Alvord, R. Leighty, et al. Kidney-Targeted Birt-Hogg-Dube Gene Inactivation in a Mouse Model: Erk1/2 and Akt-mTOR Activation, Cell Hyperproliferation, and Polycystic Kidneys J Natl Cancer Inst, January 16, 2008; 100(2): 140 - 154. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Gunji, T. Akiyoshi, T. Sato, M. Kurihara, S. Tominaga, K. Takahashi, and K. Seyama Mutations of the Birt Hogg Dube gene in patients with multiple lung cysts and recurrent pneumothorax J. Med. Genet., September 1, 2007; 44(9): 588 - 593. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. van Slegtenhorst, D. Khabibullin, T. R. Hartman, E. Nicolas, W. D. Kruger, and E. P. Henske The Birt-Hogg-Dube and Tuberous Sclerosis Complex Homologs Have Opposing Roles in Amino Acid Homeostasis in Schizosaccharomyces pombe J. Biol. Chem., August 24, 2007; 282(34): 24583 - 24590. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. M. Linehan, P. A. Pinto, R. Srinivasan, M. Merino, P. Choyke, L. Choyke, J. Coleman, J. Toro, G. Glenn, C. Vocke, et al. Identification of the Genes for Kidney Cancer: Opportunity for Disease-Specific Targeted Therapeutics Clin. Cancer Res., January 15, 2007; 13(2): 671s - 679s. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Iliopoulos Molecular Biology of Renal Cell Cancer and the Identification of Therapeutic Targets J. Clin. Oncol., December 10, 2006; 24(35): 5593 - 5600. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Baba, S.-B. Hong, N. Sharma, M. B. Warren, M. L. Nickerson, A. Iwamatsu, D. Esposito, W. K. Gillette, R. F. Hopkins III, J. L. Hartley, et al. Folliculin encoded by the BHD gene interacts with a binding protein, FNIP1, and AMPK, and is involved in AMPK and mTOR signaling PNAS, October 17, 2006; 103(42): 15552 - 15557. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||








