Skip Navigation

JNCI Journal of the National Cancer Institute 2003 95(16):1254-1255; doi:10.1093/jnci/djg042
© 2003 by Oxford University Press
This Article
Right arrow Extract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Request Permissions
Google Scholar
Right arrow Articles by Bonnet-Duquennoy, M.
Right arrow Articles by Joab, I.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Bonnet-Duquennoy, M.
Right arrow Articles by Joab, I.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© 2003 Oxford University Press

CORRESPONDENCE

RESPONSE: Absence of the Epstein–Barr Virus Genome in Breast Cancer–Derived Cell Lines

Mathilde Bonnet-Duquennoy, Arbach Haratech, Barbara Vandest, Florence Lefeu, Irène Joab

Affiliation of authors: Institut National de la Santé et de la Recherche Médicale, EMI 03-34, Institut Universitaire d’Hématologie, Pharmacologie Expérimentale et Clinique, Paris, France.

Correspondence to: Irène Joab, PhD, Institut National de la Santé et de la Recherche Médicale, EMI 03-34, Institut Universitaire d’Hématologie, Pharmacologie Expérimentale et Clinique, 27 rue Juliette Dodu, 75010 Paris, France (e-mail: i.joab{at}chu-stlouis.fr).

The association of Epstein–Barr virus (EBV) with breast cancer has been reported in several studies [cited in (1)], including one by us (2). However, other studies detected neither the EBV genome nor its gene products in breast cancer biopsy specimens (1). Speck et al. tested 22 breast cancer–derived cell lines for the presence of EBV DNA by the polymerase chain reaction (PCR) using primers specific for LMP2 and BHRF1 viral genes. No EBV DNA was amplified in these cell lines.

In our laboratory, we have tested eight breast cancer cell lines from the American Type Culture Collection (Manassas, VA). The cell lines are identical to those tested by Speck et al. (T47D, BT-474, ZR-75-1, MCF7, MDA-MB-134, MDA-MB-231, and MDA-MB-361), with the exception of VHB-1. The presence of the viral genome was analyzed by PCR using primers specific for a region of the EBNA-3B gene (coordinates 95583–96157) (sense primer: ATGAGCAGGAGCACAATGGT, antisense primer: AAAGTGACCTAGCAAGTGACCTAGCACGACGT). The sensitivity of the PCR technique was sufficient to detect two copies of the Namalwa EBV genome. Glyceraldehyde 3-phosphatase dehydrogenase (GAPDH) amplification was used as the positive control for DNA integrity (sense primer: GGCCTCCAAGGAGTAAGACC, antisense primer: CCCCTCTTCAAGGGGTCTAC). Although a PCR product for GAPDH was obtained, no PCR products for EBNA-3B were detected in any of the eight tested cell lines (data not shown). Therefore, we concluded that these breast carcinoma cell lines were not constitutively infected by EBV.

None of the breast cancer cell lines tested by Speck et al. and/or by us contained the EBV genome. We agree that if EBV had been involved in the oncogenesis of these breast cancer cases, it has not persisted in the resulting cell lines. We also agree that this result does not rule out the possibility of an association between EBV and breast cancer. As suggested by Speck et al., the virus may participate in oncogenesis and then leave. Alternatively, EBV infection may have been lost in culture. We in vitro infected MDA-MB-231 cells with a recombinant EBV harboring the neomycin resistance gene (3) and selected several clones. Two of the infected clones were cultured from passage 66 to 73 without G418. The viral load was measured by real-time PCR for the EBV EBER gene [primer sequences can be found in (2); PCR was monitored with the SYBR Green I dye]. Genomic DNA was quantified by amplification of the {beta}-globin gene; standardization was performed with the LightCycler control kit DNA (Roche Molecular Diagnostics, Meylan, France). After seven passages without selection for EBV-infected breast carcinoma cells, the number of EBV genomes had decreased by approximately half, whereas after seven passages in selection medium, the number of EBV genomes was comparable to the initial number (Table 1Go). Undifferentiated nasopharyngeal carcinoma (NPC) is a well-documented EBV-associated disease. It is also well known that EBV-associated carcinoma cell lines (i.e., NPC cell lines) either do not harbor EBV or lose it after long-term culture (4). C666-1 (5) is the only NPC cell line that consistently harbors EBV. Thus, even if breast cancer is associated with EBV, the viral genome might have been lost in long-term culture and derived cell lines are devoid of viral genome.


View this table:
[in this window]
[in a new window]
 
Table 1. EBV viral load in mammary epithelial cells in culture*
 

We thank Nathan La Borde for careful reading of the manuscript.

REFERENCES

1 Murray PG, Lissauer D, Junying J, Davies G, Moore S, Bell A, et al. Reactivity with a monoclonal antibody to Epstein-Barr virus (EBV) nuclear antigen 1 defines a subset of aggressive breast cancers in the absence of the EBV genome. Cancer Res 2003;63:2338–43.[Abstract/Free Full Text]

2 Bonnet M, Guinebretiere JM, Kremmer E, Grunewald V, Benhamou E, Contesso G, et al. Detection of Epstein-Barr virus in invasive breast cancers. J Natl Cancer Inst 1999;91:1376–81.[Abstract/Free Full Text]

3 Shimizu N, Yoshiyama H, Takada K. Clonal propagation of Epstein-Barr virus (EBV) recombinants in EBV-negative Akata cells. J Virol 1996;70:7260–3.[Abstract/Free Full Text]

4 Yao K, Zhang HY, Zhu HC, Wang FX, Li GY, Wen DS, et al. Establishment and characterization of two epithelial tumor cell lines (HNE-1 and Hone-1) latently infected with Epstein-Barr virus and derived from nasopharyngeal carcinomas. Int J Cancer 1990;45:83–9.[Web of Science][Medline]

5 Cheung ST, Huang DP, Hui AB, Lo KW, Ko CW, Tsang YS, et al. Nasopharyngeal carcinoma cell line (C666–1) consistently harbouring Epstein-Barr virus. Int J Cancer 1999;83:121–6.[CrossRef][Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Extract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Request Permissions
Google Scholar
Right arrow Articles by Bonnet-Duquennoy, M.
Right arrow Articles by Joab, I.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Bonnet-Duquennoy, M.
Right arrow Articles by Joab, I.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?