Skip Navigation

JNCI Journal of the National Cancer Institute 2003 95(16):1253-1254; doi:10.1093/jnci/djg041
© 2003 by Oxford University Press
This Article
Right arrow Extract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (2)
Right arrow Request Permissions
Google Scholar
Right arrow Articles by Speck, P.
Right arrow Articles by Longnecker, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Speck, P.
Right arrow Articles by Longnecker, R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© 2003 Oxford University Press

CORRESPONDENCE

Absence of the Epstein–Barr Virus Genome in Breast Cancer–Derived Cell Lines

Peter Speck, David F. Callen, Richard Longnecker

Affiliation of authors: P. Speck, Infectious Diseases Laboratories, Institute of Medical and Veterinary Science, Adelaide, Australia; R. Longnecker: Microbiology/Immunology Department, Northwestern University, Chicago, IL; D. Callen, Department of Medicine, University of Adelaide, Adelaide.

Correspondence to: Richard Longnecker, PhD, Microbiology/Immunology Department, Northwestern University, 303 E. Chicago Ave., Chicago, IL 60611 (e-mail: r-longnecker{at}northwestern.edu).

A controversy regarding the association of Epstein–Barr virus (EBV) with breast cancer has recently been reported in the literature. Numerous studies, beginning with one published in 1995 (1) and, more recently, one published in the Journal (2), report the presence of viral genomes and viral gene expression in samples of breast cancer tissues. Conversely, many other surveys of breast cancer biopsy specimens, including one published by us (3), did not detect EBV or EBV gene products.

The precedent created by detection of human papilloma virus DNA in the cervical cancer–derived cell lines HeLa, KB, and C4–1 (4) prompted us to survey breast cancer–derived cell lines for EBV genomes. We reasoned that detection of EBV DNA would strengthen the case for EBV involvement in breast cancer. We tested cells from the following 22 breast cancer–derived lines: BT-20, BT-474, BT-483, BT-549, CAMA-1, DU4475, Hs 578t, MCF-7, MDA-MB-134, MDA-MB-157, MDA-MB-175, MDA-MB-231, MDA-MB-361, MDA-MB-415, MDA-MB-436, MDA-MB-453, MDA-MB-468, SK-BR-3, T-47D, UACC-893, ZR-75-1, and ZR-75-30. The lines MCF-12a and HBL-100 (derived from noncancerous breast tissue) and LNCaP and PC-3DNA (prostate cancer–derived) were also tested. All cell lines were obtained from the American Type Culture Collection (Manassas, VA). DNA samples were prepared by a standard alkali lysis method and analyzed by polymerase chain reaction (PCR) using a standard protocol (5) with primers specific for EBV genes LMP2 or BHRF1. {beta}-actin was used as a control for the efficacy of the PCR. Primers detecting EBV gene LMP2 were PS003, TTCTTGCCCGTTCTCTTTCTTAG and PS004, CTTCTGTACGCTAGTATCAGGAGC, which amplify a 546-base-pair (bp) fragment. Primers for EBV gene BHRF1 were BHFR1-C, TGCATGGAAATGGTA and BHRF1-D, AAGGCTTGGGTCTCC, which amplify a 239-bp product. Primers detecting {beta}-actin were {beta}actinF, CTGGCACCACACCTTCTACAATGAGCTGCG and {beta}actinR, CGTCATACTCCTGCTTGCTGATCCACATCTGC, which amplify an 838-bp product. The sensitivity of this detection method has been examined (6) and exceeds that required to detect the two EBV genomes/cell present in Namalwa cells, which are used as a positive control. EBV DNA was detected from 10 or 50 ng of Namalwa cell DNA (Fig. 1Go), whereas 100 ng of DNA was assayed for each line tested.



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 1. Lack of detection of Epstein–Barr Virus (EBV) genomes in DNA from breast cancer–derived cell lines. DNA samples from 22 breast cancer–derived cell lines and from four non-breast cancer–derived cell lines were analyzed for the presence of EBV by polymerase chain reaction (PCR). PCR primers for EBV genes LMP2 (546-base-pair [bp] product) or BHRF1 (239-bp product) were used, and primers for the {beta}-actin gene (838-bp product) were included as a control of the efficacy of the reaction. Agarose gel electrophoresis was used to examine the size and presence of DNA products from the PCR reaction, a subset of which is shown. Two copies of the EBV genome per Namalwa cell were detected using 10, 50, or 200 ng of sample. Test samples were analyzed using 100 ng of DNA. EBV DNA was not detected in any of the breast cancer–derived cell lines. Representative samples from the cell lines BT-20, BT-474, CAMA-1, T-47D, and MCF-7 are shown. {beta}-actin was readily detected in all samples analyzed.

 
None of the cell lines tested contained EBV genomes (Fig. 1Go). This result indicates that, if EBV was involved in oncogenesis in these breast cancer cases, it has not persisted in the resulting cell lines. This result is inconsistent with an association between EBV and breast cancer development, but does not rule it out. This is because EBV may contribute to oncogenesis and persist in immortalized cells in a subset of tumors, of which our sample of cell lines is not representative. The American Type Culture Collection database shows at least 51 breast cancer–derived cell lines, so as-yet-untested lines may harbor EBV. Alternatively, the virus may participate in oncogenesis and then leave, as in a "hit-and-run" mechanism. In view of the typical persistence of EBV in episomal form, and observations of viral loss from transformed cell lines without loss of transformed phenotype, it has been suggested that a role for EBV in many virus-negative tumors cannot be excluded (7). Further research will be required to determine whether EBV has a role, and if so, what role, in breast cancer.

Supported by project grants 104480 (to P. Speck) and 207703 (to D. F. Callen) from the National Health and Medical Research Council of Australia. R. Longnecker is a Stohlman Scholar of the Leukemia and Lymphoma Society of America and is supported by Public Health Service grants CA62234 and CA73507 (from the National Cancer Institute) and DE13127 (from the National Institute of Dental and Craniofacial Research), National Institutes of Health, Department of Health and Human Service.

REFERENCES

1 Labrecque LG, Barnes DM, Fentiman IS, Griffin BE. Epstein-Barr virus in epithelial cell tumors: a breast cancer study. Cancer Res 1995;55:39–45.[Abstract/Free Full Text]

2 Bonnet M, Guinebretiere JM, Kremmer E, Grunewald V, Benhamou E, Contesso G, et al. Detection of Epstein-Barr virus in invasive breast cancers. J Natl Cancer Inst 1999;91:1376–81.[Abstract/Free Full Text]

3 Deshpande CG, Badve S, Kidwai N, Longnecker R. Lack of expression of the Epstein-Barr virus (EBV) gene products, EBERs, EBNA1, LMP1, and LMP2A, in breast cancer cells. Lab Invest 2002;82:1193–9.[ISI][Medline]

4 Boshart M, Gissmann L, Ikenberg H, Kleinheinz A, Scheurlen W, zur Hausen H. A new type of papillomavirus DNA, its presence in genital cancer biopsies and in cell lines derived from cervical cancer. EMBO J 1984;3:1151–7.[ISI][Medline]

5 Vahey MT, Wong MT, Michael NL. A standard PCR protocol: rapid isolation of DNA and PCR assay for b-globin. In: Dieffenbach CW, Dveksler GS, editors. PCR primer: a laboratory manual. New York (NY): Cold Spring Harbor Laboratory Press; 1995. p. 17–22.

6 Speck P, Kline KA, Cheresh P, Longnecker R. Epstein-Barr virus lacking latent membrane protein 2 immortalizes B cells with efficiency indistinguishable from that of wild-type virus. J Gen Virol 1999;80:2193–9.[Abstract/Free Full Text]

7 Ambinder RF. Gammaherpesviruses and "Hit-and-Run" oncogenesis. Am J Pathol 2000;156:1–3.[Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Extract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (2)
Right arrow Request Permissions
Google Scholar
Right arrow Articles by Speck, P.
Right arrow Articles by Longnecker, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Speck, P.
Right arrow Articles by Longnecker, R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?