© 2003 by Oxford University Press
© 2003 Oxford University Press
CORRESPONDENCE |
Absence of the EpsteinBarr Virus Genome in Breast CancerDerived Cell Lines
Affiliation of authors: P. Speck, Infectious Diseases Laboratories, Institute of Medical and Veterinary Science, Adelaide, Australia; R. Longnecker: Microbiology/Immunology Department, Northwestern University, Chicago, IL; D. Callen, Department of Medicine, University of Adelaide, Adelaide.
Correspondence to: Richard Longnecker, PhD, Microbiology/Immunology Department, Northwestern University, 303 E. Chicago Ave., Chicago, IL 60611 (e-mail: r-longnecker{at}northwestern.edu).
A controversy regarding the association of EpsteinBarr virus (EBV) with breast cancer has recently been reported in the literature. Numerous studies, beginning with one published in 1995 (1) and, more recently, one published in the Journal (2), report the presence of viral genomes and viral gene expression in samples of breast cancer tissues. Conversely, many other surveys of breast cancer biopsy specimens, including one published by us (3), did not detect EBV or EBV gene products.
The precedent created by detection of human papilloma virus DNA in the cervical cancerderived cell lines HeLa, KB, and C41 (4) prompted us to survey breast cancerderived cell lines for EBV genomes. We reasoned that detection of EBV DNA would strengthen the case for EBV involvement in breast cancer. We tested cells from the following 22 breast cancerderived lines: BT-20, BT-474, BT-483, BT-549, CAMA-1, DU4475, Hs 578t, MCF-7, MDA-MB-134, MDA-MB-157, MDA-MB-175, MDA-MB-231, MDA-MB-361, MDA-MB-415, MDA-MB-436, MDA-MB-453, MDA-MB-468, SK-BR-3, T-47D, UACC-893, ZR-75-1, and ZR-75-30. The lines MCF-12a and HBL-100 (derived from noncancerous breast tissue) and LNCaP and PC-3DNA (prostate cancerderived) were also tested. All cell lines were obtained from the American Type Culture Collection (Manassas, VA). DNA samples were prepared by a standard alkali lysis method and analyzed by polymerase chain reaction (PCR) using a standard protocol (5) with primers specific for EBV genes LMP2 or BHRF1.
-actin was used as a control for the efficacy of the PCR. Primers detecting EBV gene LMP2 were PS003, TTCTTGCCCGTTCTCTTTCTTAG and PS004, CTTCTGTACGCTAGTATCAGGAGC, which amplify a 546-base-pair (bp) fragment. Primers for EBV gene BHRF1 were BHFR1-C, TGCATGGAAATGGTA and BHRF1-D, AAGGCTTGGGTCTCC, which amplify a 239-bp product. Primers detecting
-actin were
actinF, CTGGCACCACACCTTCTACAATGAGCTGCG and
actinR, CGTCATACTCCTGCTTGCTGATCCACATCTGC, which amplify an 838-bp product. The sensitivity of this detection method has been examined (6) and exceeds that required to detect the two EBV genomes/cell present in Namalwa cells, which are used as a positive control. EBV DNA was detected from 10 or 50 ng of Namalwa cell DNA (Fig. 1
), whereas 100 ng of DNA was assayed for each line tested.
|
None of the cell lines tested contained EBV genomes (Fig. 1
Supported by project grants 104480 (to P. Speck) and 207703 (to D. F. Callen) from the National Health and Medical Research Council of Australia. R. Longnecker is a Stohlman Scholar of the Leukemia and Lymphoma Society of America and is supported by Public Health Service grants CA62234 and CA73507 (from the National Cancer Institute) and DE13127 (from the National Institute of Dental and Craniofacial Research), National Institutes of Health, Department of Health and Human Service.
REFERENCES
1 Labrecque LG, Barnes DM, Fentiman IS, Griffin BE. Epstein-Barr virus in epithelial cell tumors: a breast cancer study. Cancer Res
1995;55:3945.
2 Bonnet M, Guinebretiere JM, Kremmer E, Grunewald V, Benhamou E, Contesso G, et al. Detection of Epstein-Barr virus in invasive breast cancers. J Natl Cancer Inst
1999;91:137681.
3 Deshpande CG, Badve S, Kidwai N, Longnecker R. Lack of expression of the Epstein-Barr virus (EBV) gene products, EBERs, EBNA1, LMP1, and LMP2A, in breast cancer cells. Lab Invest 2002;82:11939.[ISI][Medline]
4 Boshart M, Gissmann L, Ikenberg H, Kleinheinz A, Scheurlen W, zur Hausen H. A new type of papillomavirus DNA, its presence in genital cancer biopsies and in cell lines derived from cervical cancer. EMBO J 1984;3:11517.[ISI][Medline]
5 Vahey MT, Wong MT, Michael NL. A standard PCR protocol: rapid isolation of DNA and PCR assay for b-globin. In: Dieffenbach CW, Dveksler GS, editors. PCR primer: a laboratory manual. New York (NY): Cold Spring Harbor Laboratory Press; 1995. p. 1722.
6 Speck P, Kline KA, Cheresh P, Longnecker R. Epstein-Barr virus lacking latent membrane protein 2 immortalizes B cells with efficiency indistinguishable from that of wild-type virus. J Gen Virol
1999;80:21939.
7 Ambinder RF. Gammaherpesviruses and "Hit-and-Run" oncogenesis. Am J Pathol
2000;156:13.
![]()
CiteULike
Connotea
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
