© 2002 by Oxford University Press
Journal of the National Cancer Institute, Vol. 94, No. 11, 819-825,
June 5, 2002
© 2002 Oxford University Press
ARTICLE |
Suppression of Tumor Lymphangiogenesis and Lymph Node Metastasis by Blocking Vascular Endothelial Growth Factor Receptor 3 Signaling
Affiliations of authors: Y. He, T. Karpanen, K. Alitalo, Molecular/Cancer Biology Laboratory and Ludwig Institute for Cancer Research, Haartman Institute and Helsinki University Central Hospital, Biomedicum Helsinki, University of Helsinki, Finland; K. Kozaki, K. Koshikawa, T. Takahashi, Division of Molecular Oncology, Aichi Cancer Center Research Institute, 464-8681 Nagoya, Japan; S. Yla-Herttuala, A. I. Virtanen Institute, University of Kuopio, Finland.
Correspondence to: K. Alitalo, M.D., Ph.D., Molecular/Cancer Biology Laboratory and Ludwig Institute for Cancer Research, Biomedicum Helsinki, University of Helsinki, P.O.B. 63 (Haartmaninkatu 8), 00014 Helsinki, Finland (e-mail: Kari.Alitalo{at}Helsinki.Fi).
| ABSTRACT |
|---|
|
|
|---|
Background: Vascular endothelial growth factor C (VEGF-C) stimulates tumor lymphangiogenesis (i.e., formation of lymphatic vessels) and metastasis to regional lymph nodes by interacting with VEGF receptor 3 (VEGFR-3). We sought to determine whether inhibiting VEGFR-3 signaling, and thus tumor lymphangiogenesis, would inhibit tumor metastasis. Methods: We used the highly metastatic human lung cancer cell line NCI-H460-LNM35 (LNM35) and its parental line NCI-H460-N15 (N15) with low metastatic capacity. We inserted genes by transfection and established a stable N15 cell line secreting VEGF-C and a LNM35 cell line secreting the soluble fusion protein VEGF receptor 3-immunoglobulin (VEGFR-3-Ig, which binds VEGF-C and inhibits VEGFR-3 signaling). Control lines were transfected with mock vectors. Tumor cells were implanted subcutaneously into severe combined immunodeficient mice (n = 6 in each group), and tumors and metastases were examined 6 weeks later. In another approach, recombinant adenoviruses expressing VEGFR-3-Ig (AdR3-Ig) or
-galactosidase (AdLacZ) were injected intravenously into LNM35 tumor-bearing mice (n = 14 and 7, respectively). Results: LNM35 cells expressed higher levels of VEGF-C RNA and protein than did N15 cells. Xenograft mock vector-transfected LNM35 tumors showed more intratumoral lymphatic vessels (15.3 vessels per grid; 95% confidence interval [CI] = 13.3 to 17.4) and more metastases in draining lymph nodes (12 of 12) than VEGFR-3-Ig-transfected LNM35 tumors (4.1 vessels per grid; 95% CI = 3.4 to 4.7; P<.001, two-sided t test; and four lymph nodes with metastases of 12 lymph nodes examined). Lymph node metastasis was also inhibited in AdR3-Ig-treated mice (AdR3-Ig = 0 of 28 lymph nodes; AdLacZ = 11 of 14 lymph nodes). However, metastasis to the lungs occurred in all mice, suggesting that LNM35 cells can also spread via other mechanisms. N15 tumors overexpressing VEGF-C contained more lymphatic vessels than vector-transfected tumors but did not have increased metastatic ability. Conclusions: Lymph node metastasis appears to be regulated by additional factors besides VEGF-C. Inhibition of VEGFR-3 signaling can suppress tumor lymphangiogenesis and metastasis to regional lymph nodes but not to lungs.
| INTRODUCTION |
|---|
|
|
|---|
Tumor metastasis involves a series of complex processes that include the detachment of tumor cells from the primary tumor mass, microinvasion of tumor cells into stromal tissues, intravasation of tumor cells into the lymphatic or blood vessels, and extravasation and growth of tumor cells in secondary sites (1,2). The capacity of tumor cells to induce angiogenesis and lymphangiogenesis may regulate the probability of blood vascular or lymphatic metastasis.
The five mammalian vascular endothelial growth factor (VEGF) family members identified to date, VEGF, VEGF-B, VEGF-C, VEGF-D, and placenta growth factor (PlGF), play crucial roles in the physiologic and pathologic regulation of vasculogenesis, hematopoiesis, angiogenesis, lymphangiogenesis, and vascular permeability (35). Almost all types of cancer cells express VEGF, which uses VEGF receptor 1 (VEGFR-1) and VEGFR-2 for signaling. Associations have been observed for VEGF expression, the vascular density in human tumors, and patient prognosis (3,6). VEGF-C and VEGF-D have been identified as specific lymphangiogenic factors, which bind to and induce tyrosine phosphorylation of VEGFR-3 (79). These factors stimulate lymphangiogenesis in vivo, for example, in the avian chorioallantoic membrane and in the skin of transgenic mice (1012). Both factors are produced as prepropolypeptides that are proteolytically processed to mature forms. The mature factors have higher affinities for VEGFR-3 and can bind to and activate VEGFR-2. Both factors can also exert angiogenic activity through VEGFR-2 (1315).
VEGFR-3 signaling regulates the formation of the primary cardiovascular network in embryos (16) and the development and growth of the lymphatic system (4,17). Expression of VEGFR-3 becomes restricted mainly to lymphatic vessels after midgestation (18,19). However, VEGFR-3 expression in tumors has been detected in both blood and lymphatic vessels (2022). An association of VEGF-C expression with tumor lymphangiogenesis and with lymph node metastasis has been observed in many cancers including thyroid, prostate, gastric, colorectal, and lung cancers (2). Several studies have demonstrated that overexpression of VEGF-C or VEGF-D induces lymphangiogenesis and promotes tumor metastasis in mouse tumor models (2326). These results provide one mechanism for the observed involvement of lymphatic vessels in tumor metastasis. Furthermore, a soluble VEGFR-3-Ig fusion protein has been shown to inhibit VEGF-C-induced tumor lymphangiogenesis (26). To investigate whether the inhibition of lymphangiogenesis is sufficient to block tumor metastasis, we studied the human lung cancer cell line NCI-H460-LNM35, because it has a high frequency of lymphatic metastasis (27), and its parental cell line NCI-H460-N15, which has a low metastatic capacity.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell Lines and Transfections
The human lung cancer cell line NCI-H460-LNM35 (hereafter LNM35) is a subline of NCI-H460-N15 (hereafter N15), a human large-cell carcinoma of the lung, established as previously described (27,28). LNM35 cells and N15 cells were maintained in RPMI-1640 medium supplemented with 2 mM L-glutamine, penicillin (100 U/mL), streptomycin (100 µg/mL), and 10% fetal bovine serum (Autogen Bioclear, Calne, U.K.). LNM35 cells were transfected with the pEBS7/VEGFR-3-Ig vector (26) or with the pEBS7 vector, and N15 cells were transfected with the pEBS7/VEGF-C (26) vector or with pEBS7 by the use of liposomes (FuGENE 6; Roche, Indianapolis, IN). Transfected cells were then selected in hygromycin (400 µg/mL; Calbiochem, La Jolla, CA) until resistant cell pools were obtained.
Xenotransplantation and Analysis of Tumors
All experiments performed on animals were in accord with institutional guidelines. Approximately 1.0 x 107 LNM35/VEGFR-3-Ig, LNM35/pEBS7, N15/VEGF-C, or N15/pEBS7 cells in 100 µL serum-free medium were implanted in the subcutaneous tissue of the right abdominal wall of female severe combined immunodeficient (SCID) mice (78 wk old, one tumor per mouse, n = 6 mice per group). Tumors were measured with digital calipers, and the tumor volumes (as cubic millimeters) were calculated as follows: volume = length x width2 x 0.52. Mice were killed after 6 weeks, and tumors, some internal organs including the lungs, and axillary lymph nodes were collected. The length and width of lymph nodes were also measured, and the lymph node volumes (as cubic millimeters) were calculated as volume = (
/6) x (length x width)3/2, as described (29). Samples of each tumor were snap-frozen in liquid nitrogen and stored at 70 °C for protein analysis or fixed immediately in 4% paraformaldehyde overnight at 4 °C and then processed for further histologic analysis.
In separate experiments, approximately 1.0 x 107 LNM35 cells were also subcutaneously implanted into SCID mice (one tumor per mouse). Recombinant adenoviruses expressing the VEGFR-3-Ig fusion protein (AdR3-Ig) (26) or
-galactosidase (AdLacZ) (30) (109 plaque-forming units) were administered via the tail vein on the day of tumor implantation (n = 14 and 7 mice, respectively). Blood from the treated and control mice was collected, and the serum concentration of VEGFR-3-Ig was determined by enzyme-linked immunosorbent assay (ELISA), as previously described (31). Mice were killed 5 weeks later, and their tissues were collected and processed as above.
Histology
Paraffin sections (6 µm) of tumors were immunostained with monoclonal antibodies against platelet endothelial cell adhesion molecule 1 (PECAM-1; PharMingen, San Diego, CA), polyclonal antibodies against lymphatic vessel endothelial hyaluronan receptor 1 (LYVE-1) (32) (a gift from Dr. David G. Jackson, University of Oxford, U.K.; and from Dr. Erkki Ruoslahti, The Burnham Institute, La Jolla, CA), or biotin-conjugated mouse anti-human IgG1 antibodies (Zymed, San Francisco, CA) as previously described (21). Sections of the lungs and axillary lymph nodes were stained with hematoxylin and eosin.
Immunoprecipitation and Western Blot Analysis
The cells were metabolically labeled in methionine-free and cysteine-free modified Eagle medium supplemented with [35S]methionine/[35S]cysteine (Promix, Amersham Pharmacia Biotech, Uppsala, Sweden) at 100 µCi/mL for about 8 hours. Conditioned medium was then harvested and cleared of particulate material by centrifugation. VEGF-C was immunoprecipitated from the medium with polyclonal antibodies against VEGF-C (33), and then the antigenantibody complexes were incubated with protein A-Sepharose (Amersham Pharmacia Biotech). Complexes were then washed twice with 0.5% bovine serum albumin/0.02% Tween 20 in phosphate-buffered saline (PBS), washed once with PBS, and separated by sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDSPAGE) under reducing conditions.
Expression of the soluble VEGFR-3-Ig fusion protein in conditioned medium from cell cultures and cell lysates from tumor samples was examined. Briefly, frozen tumor samples were homogenized on ice in the lysis buffer (20 mM TrisHCl [pH 7.6], 1 mM EDTA, 50 mM NaCl, 50 mM NaF, 1% Triton-X100, supplemented with 1 mM phenylmethylsulfonyl fluoride, approtinin [1 mU/mL], 1 mM Na3VO4, and leupeptin [10 µg/mL]). The fusion protein in LNM35/VEGFR-3-Ig cell-conditioned medium or tumor lysates (equal amounts of total protein [1.5 mg]) was bound to protein A-Sepharose, as determined by the BCA protein assay (Pierce, Rockford, IL). Bound proteins were dissolved in reducing SDSPAGE sample buffer, separated by SDSPAGE in 8% gels, and transferred to nitrocellulose. Blots were probed with horseradish peroxidase-conjugated goat anti-human IgG (Fc) antibody (KPL, Gaithersburg, MD) and developed with the enhanced chemiluminescence detection system.
Analysis of RNA
RNA was extracted from LNM35 and N15 cells, and northern blot and hybridization analyses were performed. Complementary DNA probes were generated by a polymerase chain reaction using the following primers: VEGF sense primer = AGCTCTAGACATCACGAAGTGGTGAAGTT and antisense primer = AGCGAATTCTTGTCACATCTGCAAGTACG; VEGF-B sense primer = AGCTCTAGAAGATGTGTATACTCGCGCTA and antisense primer = AGCGAATTCCCTTGGCAACGGAGGAAGCT; VEGF-C sense primer = AGCTCTAGACCAGTGTAGATGAACTCATG and antisense primer = AGCGAATTCAGCCAGGCATCTGCAGATGT; VEGF-D sense primer = AGCTCTAGATGTAAGTGCTTGCCAACAGC and antisense primer = AGCGAATTCAGCGGCAATGCTTTGCACAT.
Statistical Analysis
Statistical analysis was performed with the unpaired t test. All statistical tests were two-sided.
| RESULTS |
|---|
|
|
|---|
Analysis of VEGF-C and VEGF-D Expression
We examined the expression of VEGFs in LNM35 cells, which, in mice, consistently show lymphogenous metastasis, and its parental cell line, N15, which is derived from a human large-cell carcinoma of the lung and does not show lymphogenous metastasis (27). By use of northern blot and hybridization analyses, we detected equal levels of VEGF and VEGF-B mRNA in both cell lines, but the level of VEGF-C mRNA was considerably higher in LNM35 cells than in N15 cells (Fig. 1, A
). VEGF-D mRNA was not detected in either line. Enhanced secretion of VEGF-C protein by LNM35 cells was confirmed by immunoprecipitation with polyclonal antibodies against VEGF-C (Fig. 1, B
). We also confirmed that N15 cells transfected with a VEGF-C expression vector secreted high levels of VEGF-C into the culture medium (Fig. 1, B
).
|
Establishment of LNM35 Cells Overexpressing VEGFR-3-Ig
To study the effect of soluble VEGFR-3-Ig expression on tumor lymphangiogenesis, LNM35 cells were transfected with the pEBS7/VEGFR-3-Ig expression vector, and pools of hygromycin-selected cell clones were isolated. These pools were characterized for protein secretion by metabolic labeling and immunoprecipitation (data not shown) and by western blot analysis. VEGFR-3-Ig fusion protein was detected in serum-free medium conditioned by VEGFR-3-Ig-transfected cells (LNM35/VEGFR-3-Ig cells) but not in that of LNM35 cells transfected with pEBS7 (LNM35/pEBS7) (Fig. 1, C
). Cells from both pools were microscopically indistinguishable and had similar growth rates in vitro (data not shown).
Persistent Expression of VEGFR-3-Ig in Tumors
LNM35/pEBS7 and LNM35/VEGFR-3-Ig cells were subcutaneously injected into the right abdominal wall of SCID mice. As shown in Fig. 2, A
, the tumors formed by the two cell lines in vivo had similar growth rates. Tumors were excised 6 weeks after implantation, and tumor lysates were analyzed by western blotting with antibodies against the Fc portion of human IgG. Expression of VEGFR-3-Ig protein was detected in LNM35/VEGFR-3-Ig tumors (Fig. 2, B
) and then confirmed by immunohistochemical analysis of tumors (Fig. 2, D
) and lung metastases (Fig. 2, F
). No staining was obtained in tumors or metastases generated by vector-transfected cells (Fig. 2, C and E
).
|
Inhibition of Tumor Lymphangiogenesis by VEGFR-3-Ig
Lymphatic vessels in the tumors were analyzed by immunostaining with antibodies against the lymphatic endothelial marker LYVE-1 (32,34). LYVE-1-positive vessel-like structures were found in control LNM35 tumors (Fig. 3, A
), often in clusters, and hyperplastic lymphatic vessels filled with tumor cells were observed in the tumor periphery (Fig. 3, C
). In contrast, few LYVE-1-positive vessel-like structures were observed in VEGFR-3-Ig tumors (Fig. 3, B and D
). The mean number of LYVE-1-positive vessels was determined from three microscopic fields with the highest vessel density, as shown in Fig. 3, I
, as follows: VEGFR-3-Ig = 4.1 vessels per grid (95% confidence interval [CI] = 3.4 to 4.7) and control = 15.3 (95% CI = 13.3 to 17.4; n = 6 tumors per group; Ph.001, two-sided t test). PECAM-1 (Fig. 3, E and F
), a panendothelial marker, detected a statistically significant difference in vessel density between the control LNM35 tumors and transfected LNM35 tumors secreting soluble VEGFR-3-Ig, as shown in Fig. 3, I
, as follows: VEGFR-3-Ig = 17.1 vessels per grid (95% CI = 13.2 to 20.9) and control = 23.9 vessels per grid (95% CI = 17.7 to 30.0; n = 6; P = .022). A slight trend toward higher PECAM-1 vessel density and the occurrence of larger vessels in the vector-transfected tumors may depend on the fact that lymphatic vessels were also stained by the anti-PECAM-1 antibodies. Inhibition of intratumoral and peritumoral lymphangiogenesis was also observed in mice treated with AdR3-Ig (data not shown).
|
Much lower levels of lymphangiogenesis were detected in N15 tumors than in LNM35 tumors (Fig. 3, G
Suppression of Axillary Lymph Node Metastasis
Fig. 4, A
, shows representative axillary lymph nodes found in tumor-bearing mice. The mean lymph node volume was 14.6 mm3 (95% CI = 0 to 39.9) in the VEGFR-3-Ig group (n = 12 lymph nodes total), and the mean volume was 71.6 mm3 (95% CI = 10.7 to 132.6) in the control group (n = 12 lymph nodes total; Fig. 4, B
). One large metastatic lymph node was detected in the VEGFR-3-Ig group, but only low levels of soluble receptor were detected in the corresponding tumor. Thus, a statistically significant difference was not found in lymph node sizes between the two groups (P = .070). Histologic analysis revealed that all 12 lymph nodes from the control group but only four of 12 lymph nodes from the VEGFR-3-Ig group contained metastases. Typical lymph node sections stained with hematoxylin and eosin are shown in Fig. 4, C and D
.
|
LNM35 tumor-bearing mice treated with AdR3-Ig had high serum concentrations of the VEGFR3-Ig fusion protein (Fig. 5, A
|
No difference in lymph node size was observed between the N15/VEGF-C and N15/pEBS7 groups (data not shown), and metastasis to the lymph nodes was not increased in mice bearing N15/VEGF-C tumors.
Lung Metastasis
Numerous metastatic tumor nodules in the lungs were observed in the VEGFR-3-Ig-expressing group (Fig. 6, A and B
) and the control group (Fig. 6, E and F
). Lung metastases were also observed in AdR3-Ig-treated mice and control mice. No statistically significant difference was observed in the number of tumor nodules between the two groups (data not shown). More visible tumor nodules were always found on the anterior side of the lungs (Fig. 6, B and F
) than on the posterior side (Fig. 6 A and E
). Histologic analysis revealed that metastatic cells invaded lung tissue and did not grow just by expansion (Fig. 6, C, D, G, and H
).
|
| DISCUSSION |
|---|
|
|
|---|
This study demonstrates, to our knowledge for the first time, that inhibition of VEGFR-3 signaling with a soluble fusion protein, VEGFR-3-Ig, can suppress tumor lymphangiogenesis and lymphatic metastasis but not lung metastasis. Thus, the mechanisms of lymphatic and lung metastasis may differ, at least in this model. According to our results, the overexpression of VEGF-C and the associated de novo formation of lymphatic vessels are necessary but not sufficient for the metastatic dissemination of tumor cells to the lymph nodes. Factors in addition to VEGF-C are thus apparently required for metastatic spread.
LNM35 cells can spontaneously metastasize to regional lymph nodes and lungs with an incidence of 100%, even when subcutaneously implanted (27). Because VEGF family members play important roles in tumor angiogenesis, growth, lymphangiogenesis, and metastasis, we compared expression of the VEGF family members in the highly metastatic LNM35 cells with that in the less metastatic parental N15 cells. Northern blot and immunoprecipitation analyses demonstrated that VEGF-C expression was higher in LNM35 cells than in N15 cells, but VEGF-D mRNA was not detected in either cell line. In addition, essentially no difference was detected in the expression of VEGF and VEGF-B in the two cell lines. Consistent with the VEGF-C expression results, LYVE-1-positive vessel-like structures were found at a much higher density in LNM35 tumors than in N15 tumors. These findings are in agreement with the recently published direct evidence for the role of VEGF-C in tumor lymphangiogenesis and tumor cell dissemination (23,24,26). Thus, enhanced VEGF-C expression may at least partially account for the invasion of lymphatic vessels by LNM35 cells.
Overexpression of VEGF-C in the low metastatic N15 cells was not sufficient to convert these cells to a high metastatic phenotype, and thus, additional factors may also regulate the metastatic phenotype. Our previous work showed differences in gene expression profiles between LNM35 cells and parental N15 cells (28). Enhanced expression of cyclooxygenase-2, an enzyme associated with tumor metastasis, was detected in LNM35 cells compared with N15 cells. Furthermore, N15 cells grow as clusters but LNM35 cells are only loosely attached to each other (27), and no obvious change of cell morphology was observed in N15 cells after transfection with the VEGF-C expression vector (data not shown). Such observations indicate that decreased expression of adhesion molecules may contribute to the metastatic phenotype. Finally, it is also possible that microenvironmental factors in subcutaneous tissues do not favor metastasis of the VEGF-C-overexpressing N15 lung carcinoma cells.
Hyperplastic lymphatic vessels filled with tumor cells were observed in the periphery of the LNM35 tumors. These vessels resembled the lymphatic vessels previously observed in VEGF-C-overexpressing tumors (26). In addition, lymphatic vessel clusters with open lumens were present but not evenly distributed in the tumor. This observation may reflect variations in the local tumor microenvironment, such as differences in growth factor concentrations. In contrast, in clinical cancer, intratumoral lymphatic vessels are rare (35) although regional lymph node metastases are frequently observed. Thus, peritumoral lymphatics may be responsible for lymphatic tumor spread. It has been proposed that lymphatics collapse within the tumor because of mechanical stress generated by proliferating cancer cells and the high interstitial pressure caused by plasma leakage (2,20). Thus, at least some of the intratumoral lymphatic vessels in the control LNM35 tumors may result from the trapping of peritumoral lymphatic vessels in between the growing tumor foci.
Expression of the VEGFR-3-Ig fusion protein under control of the K14 promoter in transgenic models induces apoptosis in lymphatic endothelial cells and results in the regression of lymphatic vessels formed in embryonic skin (31). However, the blood vasculature was not affected. Soluble VEGFR-3-Ig also blocked the lymphatic hyperplasia in the skin of doubly transgenic mice overexpressing VEGF-D or a mutant form of VEGF-C (VEGF-C156S) (12). These results suggested that inhibition of VEGFR-3 signaling could inhibit developmental lymphangiogenesis. To investigate whether blocking VEGFR-3 signaling affected the metastatic phenotype, we used VEGFR-3-Ig vector-transfected LNM35 cells, which persistently expressed the soluble receptor in the tumors during the study. Greater inhibition of tumor-associated lymphatic vessels was obtained in tumors produced by these cells than in tumors from the LNM35 vector-transfected cells. Intratumoral and peritumoral lymphangiogenesis was also inhibited by adenoviral expression of VEGFR-3-Ig in the liver (data not shown). This result is consistent with the inhibition of peritumoral lymphatic vessels in VEGF-C-transfected MCF-7 breast carcinoma xenografts of SCID mice infected with the recombinant adenovirus (26).
Only lymphatic vessels were stained by anti-VEGFR-3 antibodies in the skin and peritumoral areas, whereas both lymphatic and blood vessels were VEGFR-3 positive in the tumors (data not shown). VEGFR-3 induction in endothelial cells of tumor blood vessels may play a role in tumor angiogenesis (2022,36). However, in this study, the soluble VEGFR-3 fusion protein overexpressed in the tumor cells did not affect the tumor growth rate, and there was also essentially no difference in the density of intratumoral blood vessels. This result agrees with the previous result, that a soluble form of VEGFR-3 (VEGFR-3-Ig) did not inhibit tumor angiogenesis or growth (37). Thus, VEGFR-3 expressed in the endothelial cells of tumor blood vessels may have a redundant function in tumor angiogenesis, at least in some tumors.
Tumor metastasis to regional lymph nodes is common in many types of human cancers, and an association between lymphangiogenesis and tumor metastasis recently has been shown (2326). Our study extends these findings by showing that inhibition of lymphangiogenesis suppresses lymph node metastasis of a tumor that secretes high levels of endogenous VEGF-C. Histologic analysis demonstrated that most axillary lymph nodes of mice bearing the control LNM35 tumors were almost completely occupied by the tumor cells, but only one lymph node had macroscopic evidence of metastasis in mice bearing VEGFR-3-Ig-expressing tumors. A similar observation was also made in mice with a recombinant adenovirus expressing the VEGFR-3-Ig fusion protein that was injected via the tail vein at the same time that LNM35 cells were implanted subcutaneously. Strikingly, no macroscopic or microscopic metastases were observed in the axillary lymph nodes of the AdR3-Ig-treated mice by 5 weeks after tumor implantation. However, macroscopically detectable lymph node metastases were observed in control mice injected with AdLacZ. Yet lung metastases occurred in all these mice. Thus, LNM35 tumor cells can also use other mechanisms or routes, such as the bloodstream, for metastasis. Infiltration of LNM35 tumor cells into blood vessels has been described previously (27) and was also observed in this study (data not shown).
The spread of tumor cells to local lymph nodes is an early event in tumor metastasis. Results of our study show that VEGF-C expression is increased in a tumor cell line selected for lymphatic metastasis. Our results also provide, to our knowledge for the first time, direct evidence for the hypothesis that inhibition of VEGFR-3 signaling can block tumor lymphangiogenesis and suppress lymph node metastasis. However, in our cells, VEGF-C was not the only metastasis rate-limiting factor. Furthermore, evidence was obtained that the inhibition of visceral metastasis requires the blocking of other routes, such as tumor spreading via blood vessels. Further studies on the mechanisms underlying the initiation of tumor cell dissemination and the interactions of tumor cells with blood and lymphatic endothelial cells should advance our current understanding of cancer invasion.
| NOTES |
|---|
|
|
|---|
We thank David G. Jackson, University of Oxford, and Erkki Ruoslahti, The Burnham Institute, for the anti-LYVE-1 antibodies; Hajime Kubo, University of Helsinki, for the anti-VEGFR-3 antibodies and for advice regarding immunohistochemistry; Berndt Enholm, the University of Helsinki, for help with animal work; Ari Ristimaki, Helsinki University Central Hospital, for critical comments on the manuscript; and Tapio Tainola, Riikka Kivirikko, Paula Hyvarinen, and Sanna Karttunen of the University of Helsinki for excellent technical assistance. This study was supported by grants from the Ida Montini Foundation, the Ella and Georg Ehrnrooth Foundation, the Finnish Cultural Foundation, the Foundation of the Finnish Cancer Institute, the Paolo Foundation, the Finnish Academy of Sciences, and the Novo Nordisk Foundation.
| REFERENCES |
|---|
|
|
|---|
1 Sleeman JP. The lymph node as a bridgehead in the metastatic dissemination of tumors. Recent Results Cancer Res 2000;157:5581.[Medline]
2
Pepper MS. Lymphangiogenesis and tumor metastasis: myth or reality? Clin Cancer Res 2001;7:4628.
3
Ferrara N, Davis-Smyth T. The biology of vascular endothelial growth factor. Endocr Rev 1997;18:425.
4
Veikkola T, Karkkainen M, Claesson-Welsh L, Alitalo K. Regulation of angiogenesis via vascular endothelial growth factor receptors. Cancer Res 2000;60:20312.
5 Carmeliet P, Jain RK. Angiogenesis in cancer and other diseases. Nature 2000;407:24957.[CrossRef][Medline]
6 Saaristo A, Karpanen T, Alitalo K. Mechanisms of angiogenesis and their use in the inhibition of tumor growth and metastasis. Oncogene 2000;19:61229.[CrossRef][Web of Science][Medline]
7
Lee J, Gray A, Yuan J, Luoh SM, Avraham H, Wood WI. Vascular endothelial growth factor-related protein: a ligand and specific activator of the tyrosine kinase receptor Flt4. Proc Natl Acad Sci USA 1996;93:198892.
8 Joukov V, Pajusola K, Kaipainen A, Chilov D, Lahtinen I, Kukk E, et al. A novel vascular endothelial growth factor, VEGF-C, is a ligand for the Flt4 (VEGFR-3) and KDR (VEGFR-2) receptor tyrosine kinases. EMBO J 1996;15:29098.[Web of Science][Medline]
9
Achen MG, Jeltsch M, Kukk E, Makinen T, Vitali A, Wilks AF, et al. Vascular endothelial growth factor D (VEGF-D) is a ligand for the tyrosine kinases VEGF receptor 2 (Flk1) and VEGF receptor 3 (Flt4). Proc Natl Acad Sci USA 1998;95:54853.
10 Oh SJ, Jeltsch MM, Birkenhager R, McCarthy JE, Weich HA, Christ B, et al. VEGF and VEGF-C: specific induction of angiogenesis and lymphangiogenesis in the differentiated avian chorioallantoic membrane. Dev Biol 1997;188:96109.[CrossRef][Web of Science][Medline]
11
Jeltsch M, Kaipainen A, Joukov V, Meng X, Lakso M, Rauvala H, et al. Hyperplasia of lymphatic vessels in VEGF-C transgenic mice. Science 1997;276:14235.
12 Veikkola T, Jussila L, Makinen T, Karpanen T, Jeltsch M, Petrova T, et al. Signalling via vascular endothelial growth factor receptor-3 is sufficient for lymphangiogenesis in transgenic mice. EMBO J 2001;20:122331.[CrossRef][Web of Science][Medline]
13
Cao Y, Linden P, Farnebo J, Cao R, Eriksson A, Kumar V, et al. Vascular endothelial growth factor C induces angiogenesis in vivo. Proc Natl Acad Sci USA 1998;95:1438994.
14
Witzenbichler B, Asahara T, Murohara T, Silver M, Spyridopoulos I, Magner M, et al. Vascular endothelial growth factor-C (VEGF-C/VEGF-2) promotes angiogenesis in the setting of tissue ischemia. Am J Pathol 1998;153:38194.
15
Marconcini L, Marchio S, Morbidelli L, Cartocci E, Albini A, Ziche M, et al. c-fos-induced growth factor/vascular endothelial growth factor D induces angiogenesis in vivo and in vitro. Proc Natl Acad Sci USA 1999;96:96716.
16
Dumont DJ, Jussila L, Taipale J, Lymboussaki A, Mustonen T, Pajusola K, et al. Cardiovascular failure in mouse embryos deficient in VEGF receptor-3. Science 1998;282:9469.
17 Karkkainen MJ, Petrova TV. Vascular endothelial growth factor receptors in the regulation of angiogenesis and lymphangiogenesis. Oncogene 2000;19:5598605.[CrossRef][Web of Science][Medline]
18
Kaipainen A, Korhonen J, Mustonen T, van Hinsbergh VW, Fang GH, Dumont D, et al. Expression of the fms-like tyrosine kinase 4 gene becomes restricted to lymphatic endothelium during development. Proc Natl Acad Sci USA 1995;92:356670.
19 Kukk E, Lymboussaki A, Taira S, Kaipainen A, Jeltsch M, Joukov V, et al. VEGF-C receptor binding and pattern of expression with VEGFR-3 suggests a role in lymphatic vascular development. Development 1996;122:382937.[Abstract]
20
Leu AJ, Berk DA, Lymboussaki A, Alitalo K, Jain RK. Absence of functional lymphatics within a murine sarcoma: a molecular and functional evaluation. Cancer Res 2000;60:43247.
21 Partanen TA, Alitalo K, Miettinen M. Lack of lymphatic vascular specificity of vascular endothelial growth factor receptor 3 in 185 vascular tumors. Cancer 1999;86:240612.[CrossRef][Web of Science][Medline]
22
Valtola R, Salven P, Heikkila P, Taipale J, Joensuu H, Rehn M, et al. VEGFR-3 and its ligand VEGF-C are associated with angiogenesis in breast cancer. Am J Pathol 1999;154:138190.
23 Mandriota SJ, Jussila L, Jeltsch M, Compagni A, Baetens D, Prevo R, et al. Vascular endothelial growth factor-C-mediated lymphangiogenesis promotes tumour metastasis. EMBO J 2001;20:67282.[CrossRef][Web of Science][Medline]
24 Skobe M, Hawighorst T, Jackson DG, Prevo R, Janes L, Velasco P, et al. Induction of tumor lymphangiogenesis by VEGF-C promotes breast cancer metastasis. Nat Med 2001;7:1928.[CrossRef][Web of Science][Medline]
25 Stacker SA, Caesar C, Baldwin ME, Thornton GE, Williams RA, Prevo R, et al. VEGF-D promotes the metastatic spread of tumor cells via the lymphatics. Nat Med 2001;7:18691.[CrossRef][Web of Science][Medline]
26
Karpanen T, Egeblad M, Karkkainen MJ, Kubo H, Yla-Herttuala S, Jaattela M, et al. Vascular endothelial growth factor C promotes tumor lymphangiogenesis and intralymphatic tumor growth. Cancer Res 2001;61:178690.
27
Kozaki K, Miyaishi O, Tsukamoto T, Tatematsu Y, Hida T, Takahashi T. Establishment and characterization of a human lung cancer cell line NCI-H460-LNM35 with consistent lymphogenous metastasis via both subcutaneous and orthotopic propagation. Cancer Res 2000;60:253540.
28 Kozaki K, Koshikawa K, Tatematsu Y, Miyaishi O, Saito H, Hida T, et al. Multi-faceted analyses of a highly metastatic human lung cancer cell line NCI-H460-LNM35 suggest mimicry of inflammatory cells in metastasis. Oncogene 2001;20:422834.[CrossRef][Web of Science][Medline]
29
Warri AM, Huovinen RL, Laine AM, Martikainen PM, Harkonen PL. Apoptosis in toremifene-induced growth inhibition of human breast cancer cells in vivo and in vitro. J Natl Cancer Inst 1993;85:14128.
30 Laitinen M, Makinen K, Manninen H, Matsi P, Kossila M, Agrawal R, et al. Adenovirus-mediated gene transfer to lower limb artery of patients with chronic critical leg ischemia. Hum Gene Ther 1998;9:14816.[Web of Science][Medline]
31 Makinen T, Jussila L, Veikkola T, Karpanen T, Kettunen MI, Pulkkanen KJ, et al. Inhibition of lymphangiogenesis with resulting lymphedema in transgenic mice expressing soluble VEGF receptor-3. Nat Med 2001;7:199205.[CrossRef][Web of Science][Medline]
32
Prevo R, Banerji S, Ferguson DJ, Clasper S, Jackson DG. Mouse LYVE-1 is an endocytic receptor for hyaluronan in lymphatic endothelium. J Biol Chem 2001;276:1942030.
33 Joukov V, Sorsa T, Kumar V, Jeltsch M, Claesson-Welsh L, Cao Y, et al. Proteolytic processing regulates receptor specificity and activity of VEGF-C. EMBO J 1997;16:3898911.[CrossRef][Web of Science][Medline]
34
Banerji S, Ni J, Wang SX, Clasper S, Su J, Tammi R, et al. LYVE-1, a new homologue of the CD44 glycoprotein, is a lymph-specific receptor for hyaluronan. J Cell Biol 1999;144:789801.
35 de Waal RM, van Altena MC, Erhard H, Weidle UH, Nooijen PT, Ruiter DJ. Lack of lymphangiogenesis in human primary cutaneous melanoma. Consequences for the mechanism of lymphatic dissemination. Am J Pathol 1997;150:19517.[Abstract]
36
Kubo H, Fujiwara T, Jussila L, Hashi H, Ogawa M, Shimizu K, et al. Involvement of vascular endothelial growth factor receptor-3 in maintenance of integrity of endothelial cell lining during tumor angiogenesis. Blood 2000;96:54653.
37
Siemeister G, Schirner M, Weindel K, Reusch P, Menrad A, Marme D, et al. Two independent mechanisms essential for tumor angiogenesis: inhibition of human melanoma xenograft growth by interfering with either the vascular endothelial growth factor receptor pathway or the Tie-2 pathway. Cancer Res 1999;59:318591.
Manuscript received November 8, 2001; revised March 19, 2002; accepted March 29, 2002.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
S. Hirakawa, M. Detmar, D. Kerjaschki, S. Nagamatsu, K. Matsuo, A. Tanemura, N. Kamata, K. Higashikawa, H. Okazaki, K. Kameda, et al. Nodal Lymphangiogenesis and Metastasis: Role of Tumor-Induced Lymphatic Vessel Activation in Extramammary Paget's Disease Am. J. Pathol., November 1, 2009; 175(5): 2235 - 2248. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. R. Blumenschein Jr, U. Gatzemeier, F. Fossella, D. J. Stewart, L. Cupit, F. Cihon, J. O'Leary, and M. Reck Phase II, Multicenter, Uncontrolled Trial of Single-Agent Sorafenib in Patients With Relapsed or Refractory, Advanced Non-Small-Cell Lung Cancer J. Clin. Oncol., September 10, 2009; 27(26): 4274 - 4280. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Holopainen, H. Huang, C. Chen, K. E. Kim, L. Zhang, F. Zhou, W. Han, C. Li, J. Yu, J. Wu, et al. Angiopoietin-1 Overexpression Modulates Vascular Endothelium to Facilitate Tumor Cell Dissemination and Metastasis Establishment Cancer Res., June 1, 2009; 69(11): 4656 - 4664. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Yamazaki, Y. Yoshimatsu, Y. Morishita, K. Miyazono, and T. Watabe COUP-TFII regulates the functions of Prox1 in lymphatic endothelial cells through direct interaction Genes Cells, March 1, 2009; 14(3): 425 - 434. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Bogos, F. Renyi-Vamos, J. Dobos, I. Kenessey, J. Tovari, J. Timar, J. Strausz, G. Ostoros, W. Klepetko, H. J. Ankersmit, et al. High VEGFR-3-positive Circulating Lymphatic/Vascular Endothelial Progenitor Cell Level Is Associated with Poor Prognosis in Human Small Cell Lung Cancer Clin. Cancer Res., March 1, 2009; 15(5): 1741 - 1746. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Schomber, A. Zumsteg, K. Strittmatter, I. Crnic, H. Antoniadis, A. Littlewood-Evans, J. Wood, and G. Christofori Differential effects of the vascular endothelial growth factor receptor inhibitor PTK787/ZK222584 on tumor angiogenesis and tumor lymphangiogenesis Mol. Cancer Ther., January 1, 2009; 8(1): 55 - 63. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Miyazaki, N. Okada, K. Ishibashi, K. Ogata, T. Ohsawa, T. Ishiguro, H. Nakada, M. Yokoyama, M. Matsuki, H. Kato, et al. Clinical Significance of Plasma Level of Vascular Endothelial Growth Factor-C in Patients with Colorectal Cancer Jpn. J. Clin. Oncol., December 1, 2008; 38(12): 839 - 843. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kodama, Y. Kitadai, M. Tanaka, T. Kuwai, S. Tanaka, N. Oue, W. Yasui, and K. Chayama Vascular Endothelial Growth Factor C Stimulates Progression of Human Gastric Cancer via Both Autocrine and Paracrine Mechanisms Clin. Cancer Res., November 15, 2008; 14(22): 7205 - 7214. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. B. Burton, S. J. Priceman, J. L. Sung, E. Brakenhielm, D. S. An, B. Pytowski, K. Alitalo, and L. Wu Suppression of Prostate Cancer Nodal and Systemic Metastasis by Blockade of the Lymphangiogenic Axis Cancer Res., October 1, 2008; 68(19): 7828 - 7837. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. P. Padera, A. H. Kuo, T. Hoshida, S. Liao, J. Lobo, K. R. Kozak, D. Fukumura, and R. K. Jain Differential response of primary tumor versus lymphatic metastasis to VEGFR-2 and VEGFR-3 kinase inhibitors cediranib and vandetanib Mol. Cancer Ther., August 1, 2008; 7(8): 2272 - 2279. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Heckman, T. Holopainen, M. Wirzenius, S. Keskitalo, M. Jeltsch, S. Yla-Herttuala, S. R. Wedge, J. M. Jurgensmeier, and K. Alitalo The Tyrosine Kinase Inhibitor Cediranib Blocks Ligand-Induced Vascular Endothelial Growth Factor Receptor-3 Activity and Lymphangiogenesis Cancer Res., June 15, 2008; 68(12): 4754 - 4762. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. A. Resto, M. M. Burdick, N. M. Dagia, S. D. McCammon, S. M. Fennewald, and R. Sackstein L-selectin-mediated Lymphocyte-Cancer Cell Interactions under Low Fluid Shear Conditions J. Biol. Chem., June 6, 2008; 283(23): 15816 - 15824. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Hos, F. Bock, T. Dietrich, J. Onderka, F. E. Kruse, K.-H. Thierauch, and C. Cursiefen Inflammatory Corneal (Lymph)angiogenesis Is Blocked by VEGFR-Tyrosine Kinase Inhibitor ZK 261991, Resulting in Improved Graft Survival after Corneal Transplantation Invest. Ophthalmol. Vis. Sci., May 1, 2008; 49(5): 1836 - 1842. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Sini, I. Samarzija, F. Baffert, A. Littlewood-Evans, C. Schnell, A. Theuer, S. Christian, A. Boos, H. Hess-Stumpp, J. A. Foekens, et al. Inhibition of Multiple Vascular Endothelial Growth Factor Receptors (VEGFR) Blocks Lymph Node Metastases but Inhibition of VEGFR-2 Is Sufficient to Sensitize Tumor Cells to Platinum-Based Chemotherapeutics Cancer Res., March 1, 2008; 68(5): 1581 - 1592. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Kilic, L. Oliveira-Ferrer, S. Neshat-Vahid, S. Irmak, K. Obst-Pernberg, J.-H. Wurmbach, S. Loges, E. Kilic, J. Weil, H. Lauke, et al. Lymphatic reprogramming of microvascular endothelial cells by CEA-related cell adhesion molecule-1 via interaction with VEGFR-3 and Prox1 Blood, December 15, 2007; 110(13): 4223 - 4233. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. S. Sundar and T. S. Ganesan Role of Lymphangiogenesis in Cancer J. Clin. Oncol., September 20, 2007; 25(27): 4298 - 4307. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Bock, J. Onderka, T. Dietrich, B. Bachmann, F. E. Kruse, M. Paschke, G. Zahn, and C. Cursiefen Bevacizumab as a Potent Inhibitor of Inflammatory Corneal Angiogenesis and Lymphangiogenesis Invest. Ophthalmol. Vis. Sci., June 1, 2007; 48(6): 2545 - 2552. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Eichten, W. C. Hyun, and L. M. Coussens Distinctive Features of Angiogenesis and Lymphangiogenesis Determine Their Functionality during De novo Tumor Development Cancer Res., June 1, 2007; 67(11): 5211 - 5220. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. P. Padera, M. Ancukiewicz, T. Hoshida, D. Fukumura, and R. K. Jain Anti-VEGFR-3 Therapy and Lymph Node Metastasis Cancer Res., May 15, 2007; 67(10): 5055 - 5055. [Full Text] [PDF] |
||||
![]() |
A. Thomas, T Trarbach, C Bartel, D Laurent, A Henry, M Poethig, J Wang, E Masson, W Steward, U Vanhoefer, et al. A phase IB, open-label dose-escalating study of the oral angiogenesis inhibitor PTK787/ZK 222584 (PTK/ZK), in combination with FOLFOX4 chemotherapy in patients with advanced colorectal cancer Ann. Onc., April 1, 2007; 18(4): 782 - 788. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. I. Harrell, B. M. Iritani, and A. Ruddell Tumor-Induced Sentinel Lymph Node Lymphangiogenesis and Increased Lymph Flow Precede Melanoma Metastasis Am. J. Pathol., February 1, 2007; 170(2): 774 - 786. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Laakkonen, M. Waltari, T. Holopainen, T. Takahashi, B. Pytowski, P. Steiner, D. Hicklin, K. Persaud, J. R. Tonra, L. Witte, et al. Vascular Endothelial Growth Factor Receptor 3 Is Involved in Tumor Angiogenesis and Growth Cancer Res., January 15, 2007; 67(2): 593 - 599. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Wissmann and M. Detmar Pathways Targeting Tumor Lymphangiogenesis Clin. Cancer Res., December 1, 2006; 12(23): 6865 - 6868. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Yano, Y. Fujii, A. Iwai, S. Kawakami, Y. Kageyama, and K. Kihara Glucocorticoids suppress tumor lymphangiogenesis of prostate cancer cells. Clin. Cancer Res., October 15, 2006; 12(20): 6012 - 6017. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Shayan, M. G. Achen, and S. A. Stacker Lymphatic vessels in cancer metastasis: bridging the gaps Carcinogenesis, September 1, 2006; 27(9): 1729 - 1738. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hoshida, N. Isaka, J. Hagendoorn, E. di Tomaso, Y.-L. Chen, B. Pytowski, D. Fukumura, T. P. Padera, and R. K. Jain Imaging Steps of Lymphatic Metastasis Reveals That Vascular Endothelial Growth Factor-C Increases Metastasis by Increasing Delivery of Cancer Cells to Lymph Nodes: Therapeutic Implications Cancer Res., August 15, 2006; 66(16): 8065 - 8075. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Iruela-Arispe When It Comes to Blocking Lymphatics, It Is All a Question of Time Am. J. Pathol., August 1, 2006; 169(2): 347 - 350. [Full Text] [PDF] |
||||
![]() |
T. Karpanen, M. Wirzenius, T. Makinen, T. Veikkola, H. J. Haisma, M. G. Achen, S. A. Stacker, B. Pytowski, S. Yla-Herttuala, and K. Alitalo Lymphangiogenic Growth Factor Responsiveness Is Modulated by Postnatal Lymphatic Vessel Maturation Am. J. Pathol., August 1, 2006; 169(2): 708 - 718. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Allan, R. George, S. A. Vantyghem, M. W. Lee, N. C. Hodgson, C. J. Engel, R. L. Holliday, D. P. Girvan, L. A. Scott, C. O. Postenka, et al. Role of the Integrin-Binding Protein Osteopontin in Lymphatic Metastasis of Breast Cancer Am. J. Pathol., July 1, 2006; 169(1): 233 - 246. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Roberts, B. Kloos, M. Cassella, S. Podgrabinska, K. Persaud, Y. Wu, B. Pytowski, and M. Skobe Inhibition of VEGFR-3 Activation with the Antagonistic Antibody More Potently Suppresses Lymph Node and Distant Metastases than Inactivation of VEGFR-2. Cancer Res., March 1, 2006; 66(5): 2650 - 2657. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Miyata, S. Kanda, K. Ohba, K. Nomata, Y. Hayashida, J. Eguchi, T. Hayashi, and H. Kanetake Lymphangiogenesis and Angiogenesis in Bladder Cancer: Prognostic Implications and Regulation by Vascular Endothelial Growth Factors-A, -C, and -D Clin. Cancer Res., February 1, 2006; 12(3): 800 - 806. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Juttner, C. Wissmann, T. Jons, M. Vieth, J. Hertel, S. Gretschel, P. M. Schlag, W. Kemmner, and M. Hocker Vascular Endothelial Growth Factor-D and Its Receptor VEGFR-3: Two Novel Independent Prognostic Markers in Gastric Adenocarcinoma J. Clin. Oncol., January 10, 2006; 24(2): 228 - 240. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Y. Wong, H. Haack, D. Crowley, M. Barry, R. T. Bronson, and R. O. Hynes Tumor-Secreted Vascular Endothelial Growth Factor-C Is Necessary for Prostate Cancer Lymphangiogenesis, but Lymphangiogenesis Is Unnecessary for Lymph Node Metastasis Cancer Res., November 1, 2005; 65(21): 9789 - 9798. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Chen, M. L. Varney, M. W. Backora, K. Cowan, J. C. Solheim, J. E. Talmadge, and R. K. Singh Down-Regulation of Vascular Endothelial Cell Growth Factor-C Expression Using Small Interfering RNA Vectors in Mammary Tumors Inhibits Tumor Lymphangiogenesis and Spontaneous Metastasis and Enhances Survival Cancer Res., October 1, 2005; 65(19): 9004 - 9011. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Lin, A. S. Lalani, T. C. Harding, M. Gonzalez, W.-W. Wu, B. Luan, G. H. Tu, K. Koprivnikar, M. J. VanRoey, Y. He, et al. Inhibition of Lymphogenous Metastasis Using Adeno-Associated Virus-Mediated Gene Transfer of a Soluble VEGFR-3 Decoy Receptor Cancer Res., August 1, 2005; 65(15): 6901 - 6909. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Tammela, A. Saaristo, M. Lohela, T. Morisada, J. Tornberg, C. Norrmen, Y. Oike, K. Pajusola, G. Thurston, T. Suda, et al. Angiopoietin-1 promotes lymphatic sprouting and hyperplasia Blood, June 15, 2005; 105(12): 4642 - 4648. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. He, I. Rajantie, K. Pajusola, M. Jeltsch, T. Holopainen, S. Yla-Herttuala, T. Harding, K. Jooss, T. Takahashi, and K. Alitalo Vascular Endothelial Cell Growth Factor Receptor 3-Mediated Activation of Lymphatic Endothelium Is Crucial for Tumor Cell Entry and Spread via Lymphatic Vessels Cancer Res., June 1, 2005; 65(11): 4739 - 4746. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Cursiefen, S. Ikeda, P. M. Nishina, R. S. Smith, A. Ikeda, D. Jackson, J.-S. Mo, L. Chen, M. R. Dana, B. Pytowski, et al. Spontaneous Corneal Hem- and Lymphangiogenesis in Mice with Destrin-Mutation Depend on VEGFR3 Signaling Am. J. Pathol., May 1, 2005; 166(5): 1367 - 1377. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Tammela, C. Heckman, and K. Alitalo Lymphangiogenesis and Metastasis Am. Assoc. Cancer Res. Educ. Book, April 1, 2005; 2005(1): 67 - 73. [Full Text] [PDF] |
||||
![]() |
T. Tammela, B. Enholm, K. Alitalo, and K. Paavonen The biology of vascular endothelial growth factors Cardiovasc Res, February 15, 2005; 65(3): 550 - 563. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Hicklin and L. M. Ellis Role of the Vascular Endothelial Growth Factor Pathway in Tumor Growth and Angiogenesis J. Clin. Oncol., February 10, 2005; 23(5): 1011 - 1027. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Kaushal, P. Mukunyadzi, R. A. Dennis, E. R. Siegel, D. E. Johnson, and M. Kohli Stage-Specific Characterization of the Vascular Endothelial Growth Factor Axis in Prostate Cancer: Expression of Lymphangiogenic Markers Is Associated with Advanced-Stage Disease Clin. Cancer Res., January 15, 2005; 11(2): 584 - 593. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Aoki and G. Tosato Lymphatic Regeneration: New Insights From VEGFR-3 Blockade J Natl Cancer Inst, January 5, 2005; 97(1): 2 - 3. [Full Text] [PDF] |
||||
![]() |
B. Pytowski, J. Goldman, K. Persaud, Y. Wu, L. Witte, D. J. Hicklin, M. Skobe, K. C. Boardman, and M. A. Swartz Complete and Specific Inhibition of Adult Lymphatic Regeneration by a Novel VEGFR-3 Neutralizing Antibody J Natl Cancer Inst, January 5, 2005; 97(1): 14 - 21. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Alitalo, S. Mohla, and E. Ruoslahti Lymphangiogenesis and Cancer: Meeting Report Cancer Res., December 15, 2004; 64(24): 9225 - 9229. [Full Text] [PDF] |
||||
![]() |
F. Chen, K. Takenaka, E. Ogawa, K. Yanagihara, Y. Otake, H. Wada, and F. Tanaka Flt-4-Positive Endothelial Cell Density and Its Clinical Significance in Non-Small Cell Lung Cancer Clin. Cancer Res., December 15, 2004; 10(24): 8548 - 8553. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Crnic, K. Strittmatter, U. Cavallaro, L. Kopfstein, L. Jussila, K. Alitalo, and G. Christofori Loss of Neural Cell Adhesion Molecule Induces Tumor Metastasis by Up-regulating Lymphangiogenesis Cancer Res., December 1, 2004; 64(23): 8630 - 8638. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Laakkonen, M. E. Akerman, H. Biliran, M. Yang, F. Ferrer, T. Karpanen, R. M. Hoffman, and E. Ruoslahti Antitumor activity of a homing peptide that targets tumor lymphatics and tumor cells PNAS, June 22, 2004; 101(25): 9381 - 9386. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. He, I. Rajantie, M. Ilmonen, T. Makinen, M. J. Karkkainen, P. Haiko, P. Salven, and K. Alitalo Preexisting Lymphatic Endothelium but not Endothelial Progenitor Cells Are Essential for Tumor Lymphangiogenesis and Lymphatic Metastasis Cancer Res., June 1, 2004; 64(11): 3737 - 3740. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Persaud, J.-C. Tille, M. Liu, Z. Zhu, X. Jimenez, D. S. Pereira, H.-Q. Miao, L. A. Brennan, L. Witte, M. S. Pepper, et al. Involvement of the VEGF receptor 3 in tubular morphogenesis demonstrated with a human anti-human VEGFR-3 monoclonal antibody that antagonizes receptor activation by VEGF-C J. Cell Sci., June 1, 2004; 117(13): 2745 - 2756. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Sepp-Lorenzino, E. Rands, X. Mao, B. Connolly, J. Shipman, J. Antanavage, S. Hill, L. Davis, S. Beck, K. Rickert, et al. A Novel Orally Bioavailable Inhibitor of Kinase Insert Domain-Containing Receptor Induces Antiangiogenic Effects and Prevents Tumor Growth in Vivo Cancer Res., January 15, 2004; 64(2): 751 - 756. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ruddell, P. Mezquita, K. A. Brandvold, A. Farr, and B. M. Iritani B Lymphocyte-Specific c-Myc Expression Stimulates Early and Functional Expansion of the Vasculature and Lymphatics during Lymphomagenesis Am. J. Pathol., December 1, 2003; 163(6): 2233 - 2245. [Abstract] [Full Text] |
||||
![]() |
B. K. McColl, M. E. Baldwin, S. Roufail, C. Freeman, R. L. Moritz, R. J. Simpson, K. Alitalo, S. A. Stacker, and M. G. Achen Plasmin Activates the Lymphangiogenic Growth Factors VEGF-C and VEGF-D J. Exp. Med., September 15, 2003; 198(6): 863 - 868. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. T. Hall, J. L. Freeman, S. L. Asa, D. G. Jackson, and N. J. Beasley Intratumoral Lymphatics and Lymph Node Metastases in Papillary Thyroid Carcinoma Arch Otolaryngol Head Neck Surg, July 1, 2003; 129(7): 716 - 719. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Krishnan, V. Kirkin, A. Steffen, M. Hegen, D. Weih, S. Tomarev, J. Wilting, and J. P. Sleeman Differential in Vivo and in Vitro Expression of Vascular Endothelial Growth Factor (VEGF)-C and VEGF-D in Tumors and Its Relationship to Lymphatic Metastasis in Immunocompetent Rats Cancer Res., February 1, 2003; 63(3): 713 - 722. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Salven, S. Mustjoki, R. Alitalo, K. Alitalo, and S. Rafii VEGFR-3 and CD133 identify a population of CD34+ lymphatic/vascular endothelial precursor cells Blood, January 1, 2003; 101(1): 168 - 172. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Dafni, T. Israely, Z. M. Bhujwalla, L. E. Benjamin, and M. Neeman Overexpression of Vascular Endothelial Growth Factor 165 Drives Peritumor Interstitial Convection and Induces Lymphatic Drain: Magnetic Resonance Imaging, Confocal Microscopy, and Histological Tracking of Triple-labeled Albumin Cancer Res., November 15, 2002; 62(22): 6731 - 6739. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Detmar and S. Hirakawa The Formation of Lymphatic Vessels and Its Importance in the Setting of Malignancy J. Exp. Med., September 16, 2002; 196(6): 713 - 718. [Full Text] [PDF] |
||||
![]() |
A. Saaristo, T. Veikkola, T. Tammela, B. Enholm, M. J. Karkkainen, K. Pajusola, H. Bueler, S. Yla-Herttuala, and K. Alitalo Lymphangiogenic Gene Therapy With Minimal Blood Vascular Side Effects J. Exp. Med., September 16, 2002; 196(6): 719 - 730. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. K. Jain and T. P. Padera Prevention and Treatment of Lymphatic Metastasis by Antilymphangiogenic Therapy J Natl Cancer Inst, June 5, 2002; 94(11): 785 - 787. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
























