© 2001 by Oxford University Press
Journal of the National Cancer Institute, Vol. 93, No. 2, 148-150,
January 17, 2001
© 2001 Oxford University Press
BRIEF COMMUNICATION |
Epstein-Barr Virus Detection in Ductal Carcinoma of the Breast
Affiliations of authors: S. A. McCall, J. H. Lichy, K. E. Bijwaard, J. K. Taubenberger (Division of Molecular Pathology, Department of Cellular Pathology), N. S. Aguilera, W.-S. Chu (Department of Lymphatic and Hematologic Pathology), Armed Forces Institute of Pathology, Washington, DC.
Correspondence to: LTC Sherman A. McCall, M.D., Department of Cellular Pathology, Armed Forces Institute of Pathology, 14th St. and Alaska Ave., N.W., Washington, DC 20306-6000 (e-mail: McCall{at}afip.osd.mil).
Epstein-Barr virus (EBV) has been strongly linked with African Burkitt's lymphoma and nasopharyngeal carcinoma (NPC) and has recently been associated with breast cancer (1). Nine studies of EBV in breast cancer with the use of different methods (19) present conflicting results.
In the current study, microdissected ductal breast carcinomas were tested for EBV. Only one of 115 cases was positive. This finding stands in contrast to results of studies of ductal carcinoma showing up to 48% EBV positivity by polymerase chain reaction (PCR).
Bonnet et al. (1) found 51 of 100 breast cancers of all types to be PCR positive for EBV. EBV positivity was also shown by Southern blot analysis and immunostain in a subset of cases, but in situ hybridization (ISH) for EBER was negative. A similar pattern has been observed previously (2).
Our study included 115 breast cancers, chosen for having microdissectable normal, as well as intraductal, invasive, or metastatic tumor components. Intraductal carcinoma specimens were obtained from 84 patients, invasive tumor in 106 patients, metastases in 50 patients, and recurrences in six. Normal lymph node or other normal tissue was also collected, for a total of 361 samples (10). Institutional approval was received for the conduct of the study.
Samples were analyzed by 5'-nuclease PCR for the EBNA1 gene. Primers were CTGGAAATGGCCTAGGAGAGAA (nucleotides 637658; GenBank S45894) and TCCATGGTTATCACCCCCTC (nucleotides 709 728), and the probe was FAM-AGACACATCTGGACCAGAAGGCTCCGTAMRA (nucleotides 662687). PCR was performed in 50 µL with 200-nm primers and a 100-nm probe. Cycling conditions were as follows: 50 °C for 2 minutes and 95 °C for 10 minutes, followed by 50 cycles at 95 °C for 15 seconds and 60 °C for 1 minute. The assay detected a single viral copy when titrated against dilutions of a quantified EBV DNA control (Advanced Biotechnologies, Columbia, MD). DNA amplifiability was assessed with the use of the HER2 gene as a control. Primers were ATGCAGATTGCCAAGGTATGC (nucleotides 977997; GenBank M12036) and GGAAGCACCCATGTAGACCTTCT (nucleotides 10981120), and the probe was VIC-CCGGAGCAAACCCCTATGTCCACAA-TAMRA (nucleotides 10211045). A kit was used for EBER ISH (Biogenex, San Ramon CA). Immunostaining for LMP1 was performed with monoclonal antibody clones CS14 (DAKO A/S, Glostrup, Denmark).
Amplifiable DNA was obtained from 278 (77%) of 361 samples. Of these, only six samples were positive for EBNA1. EBV-positive blocks were analyzed by EBER ISH and LMP1 immunohistochemistry. Three were lymph nodestwo from cases without metastases and one from a case with metastatic carcinoma. All of these contained occasional EBER- and LMP1-positive lymphocytes; the metastatic tumor itself was negative for both EBER and LMP1.
The other three positive specimens were from one patient. In this case, both EBER and LMP1 staining demonstrated that EBV was present in 50%75% of normal ductal epithelium, as well as in the intraductal and invasive carcinoma components. The expected nuclear location of EBERs was observed (11,12). LMP1 staining was predominantly nuclear, in contrast to positive controls showing typical membrane staining (13,14).
The predominant human EBV is the B95.8 strain. Variant strains may be responsible for the epithelial tropism of NPC (15). Theoretically, variants might escape PCR detection, but a study of NPC patients with the use of primers in the variable region of EBNA1 still detected EBV in all 50 cases (16). The sensitivity of our assay was confirmed in an ethnically diverse series of NPC patients. For 13 cases with amplifiable DNA, nine (69%) were positive for EBV. Therefore, it is unlikely that our negative results were due to undetectable EBV variants.
Most investigations have used fixed tissue; however, two studies (1,3) used fresh frozen tissue and detected EBV by PCR plus either ISH or immunostain in 25%48% of ductal carcinomas. Luqmani et al. (2) performed PCR on 48 frozen and 12 fixed samples and found them to be positive in 39% and 33%, respectively. This modest gain in sensitivity in fresh tissue is insufficient to explain the discrepancies in the literature. The PCR target is another potential source of variation. Most studies yielding positive results used targets in the long internal repeat (IR1), where PCR is 10 times more sensitive than for the EBER gene (1).
While incomplete reporting and differences in methodology or diagnoses prevent strict meta-analysis, aggregate statistics for EBV detection were compiled. For all studies, PCR detected EBV in 23.8% of all patients and histologies. Given the sensitivity of PCR and the persistence of latent lymphocytic infection, this result is unsurprising. Stable, latently infected lymphocytes contain multiple EBV copies (17), and the overall positivity rate in breast cancer is no higher than that often observed in normal tissues (1823).
Microdissection is a unique advantage of this study, thereby reducing benign lymphocyte contamination. The purity of these microdissections from stromal contamination has been demonstrated by loss-of-heterozygosity analyses (10). The other published investigations (19) used lysates from whole tumors. One such study (5) demonstrated by ISH that EBV PCR positivity in breast cancer was due to latently infected lymphocytes.
Because PCR cannot distinguish between neoplastic cells and latently infected lymphocytes, high rates of positivity in breast carcinomas indicate a lack of specificity. LMP1 immunostain and EBER ISH, which provide greater specificity (24), were positive in only 6%7% of breast cancer cases reported in the literature. In contrast to conventional PCR, the use of the 5'-nuclease PCR system should improve specificity by its use of a sequence-specific probe in the reporting system.
The chief determinant of the EBV detection rate by PCR in breast cancer may be the number of cycles used. The highest rates (51% and 45%) were in large studies employing 80 cycles of nested PCR (1,2). Linear regression was performed, weighted by the number of cases in each study. After the first 28 cycles, each additional cycle was associated with an increased EBV detection of 0.85%. With a correlation coefficient of r = .780, this model is highly significant (two-sided P<.001) and accounts for 61% of the variance (Fig. 1
).
|
Proportions, like EBV detection percentages, often have greatest variance in the midrange. Hence, an angular transformation was also performed (25). The proportion of positive cases in each study was converted to its square root, and then the arcsine of the square root was calculated. Weighted linear regression still shows a highly significant relationship (two-sided P<.001) between EBV detection and the number of PCR cycles. With the use of this angular transformation, the y intercept was 14 cycles, after which EBV detection increased 0.34% per cycle. The correlation coefficient was r = .733, accounting for 54% of the variance.
At this time, a preponderance of evidence suggests that the high PCR positivity in previous studies is largely an artifact of latently infected lymphocytes. Furthermore, it seems unlikely that very low viral copy numbers detected in nested PCR would be pathologically significant. In our study, only one among 115 breast cancers had EBV present by EBNA1 PCR and in malignant cells by EBER ISH and LMP1 immunostain. The pathophysiologic significance of this finding is unclear because the possibility remains that EBV occasionally persists without any role in pathogenesis. Although it is possible that EBV causes cellular transformation in some cases, current evidence argues against an important role for this virus in breast cancer pathogenesis.
NOTES
Supported by grant DAMD 1794-J-4330 from the U.S. Army Medical Research and Material Command and by the intramural funds of the Armed Forces Institute of Pathology.
The opinions expressed by the authors do not necessarily represent an official policy or position of the Department of Defense, Department of the Army, or the Armed Forces Institute of Pathology.
REFERENCES
1
Bonnet M, Guinebretiere J, Kremmer E, Grunewald V, Benhamou E, Contesso G, et al. Detection of Epstein-Barr virus in invasive breast cancers. J Natl Cancer Inst 1999;91:137681.
2 Luqmani Y, Shousha S. Presence of Epstein-Barr virus in breast carcinoma. Int J Oncol 1995;6:899903.
3
Labrecque LG, Barnes DM, Fentimann IS, Griffin BE. Epstein-Barr virus in epithelial cell tumors: a breast cancer study. Cancer Res 1995;55:3945.
4 Lespagnard L, Cochaux P, Larsimont D, Degeyter M, Velu T, Heimann R. Absence of Epstein-Barr virus in medullary carcinoma of the breast as demonstrated by immunophenotyping, in situ hybridization and polymerase chain reaction. Am J Clin Pathol 1995;103:44952.[ISI][Medline]cancerlit;95243203
5
Horiuchi K, Mishima K, Ohsawa M, Aozasa K. Carcinoma of stomach and breast with lymphoid stroma: localisation of Epstein-Barr virus. J Clin Pathol 1994;47:53840.
6 Gaffey MJ, Frierson HF Jr, Mills SE, Boyd JC, Zarbo RJ, Simpson JF, et al. Medullary carcinoma of the breast. Identification of lymphocyte subpopulations and their significance. Mod Pathol 1993;6:7218.[ISI][Medline]cancerlit;94134677
7 Chu JS, Chen CC, Chang KJ. In situ detection of Epstein-Barr virus in breast cancer. Cancer Lett 1998;124:537.[CrossRef][ISI][Medline]cancerlit;98159827
8 Glaser SL, Ambinder RF, DiGiuseppe JA, Horn-Ross PL, Hsu JL. Absence of Epstein-Barr virus EBER-1 transcripts in an epidemiologically diverse group of breast cancers. Int J Cancer 1998;75:5558.[CrossRef][ISI][Medline]cancerlit;98126131
9 Chang KL, Chen YY, Shibata D, Weiss LM. Description of an in situ hybridization methodology for detection of Epstein-Barr virus RNA in paraffin-embedded tissues, with a survey of normal and neoplastic tissues. Diagn Mol Pathol 1992;1:24655.[Medline]cancerlit;94115771
10
Lichy JH, Zavar M, Tsai MM, O'Leary TJ, Taubenberger JK. Loss of heterozygosity on chromosome 11p15 during histological progression in microdissected ductal carcinoma of the breast. Am J Pathol 1998;153:2718.
11 Chao TY, Chow KC, Chang JY, Wang CC, Tsao TY, Harn HJ, et al. Expression of Epstein-Barr virus-encoded RNAs as a marker for metastatic undifferentiated nasopharyngeal carcinoma. Cancer 1996;78:249.[CrossRef][ISI][Medline]cancerlit;96266920
12 Uhara H, Sato Y, Mukai K, Akao I, Matsuno Y, Furuya S et al. Detection of Epstein-Barr virus DNA in Reed-Sternberg cells of Hodgkin's disease using the polymerase chain reaction and in situ hybridization. Jpn J Cancer Res 1990;81:2728.[CrossRef][ISI][Medline]cancerlit;90277514
13 Farrell PJ, Cludts I, Stuhler A. Epstein-Barr virus genes and cancer cells. Biomed Pharmacother 1997;51:25867.[CrossRef][Medline]cancerlit;97454816
14 Stewart JP, Arrand JR. Expression of the Epstein-Barr virus latent membrane protein in nasopharyngeal carcinoma biopsy specimens. Hum Pathol 1993;24:23942.[CrossRef][ISI][Medline]cancerlit;93202627
15 Gutierrez MI, Raj A, Spangler G, Sharma A, Hussain A, Judde JG, et al. Sequence variations in EBNA-1 may dictate restriction of tissue distribution of Epstein-Barr virus in normal and tumour cells. J Gen Virol 1997;78:166370.[Abstract]cancerlit;97368429
16 Vera-Sempere FJ, Burgos JS, Botella MS, Cordoba J, Gobernado M. Immunohistochemical expression of Epstein-Barr virus-encoded latent membrane protein (LMP-1) in paraffin sections of EBV-associated nasopharyngeal carcinoma in Spanish patients. Eur J Cancer B Oral Oncol 1996;32B:1638.[CrossRef]cancerlit;96306111
17 Kieff E. Epstein-Barr virus and its replication. In: Fields B, Knipe D, Howley P, Chanock R, Melnick J, Monath T, et al, editors. Fields virology. 3rd ed. Philadelphia (PA): Lippincott-Raven; 1996. p. 234396.
18 Rocchi F, Felici A, Ragona G, Heinz A. Quantitative evaluation of Epstein-Barr-virus-infected mononuclear peripheral blood leukocytes in infectious mononucleosis. N Engl J Med 1977;296:13324.
19 Miyashita EM, Yang B, Lam KM, Crawford DH, Thorley-Lawson DA. A novel form of Epstein-Barr virus latency in normal B cells in vivo. Cell 1995;80:593601.[CrossRef][ISI][Medline]cancerlit;95171454
20
Telenti A, Marshall WF, Smith TF. Detection of Epstein-Barr virus by polymerase chain reaction. J Clin Microbiol 1990;28:218790.
21
Shibata D, Weiss LM, Nathwani BN, Brynes RK, Levine AM. Epstein-Barr virus in benign lymph node biopsies from individuals infected with the human immunodeficiency virus is associated with the concurrent or subsequent development of non-Hodgkin's lymphoma. Blood 1991;77:152733.
22
Saito I, Servenius B, Compton T, Fox RI. Detection of Epstein-Barr virus DNA by polymerase chain reaction in blood and tissue biopsies from patients with Sjogren's syndrome. J Exp Med 1989;169:21918.
23 Gopal MR, Thomson BJ, Fox J, Tedder RS, Honess RW. Detection by PCR of HHV-6 and EBV DNA in blood and oropharynx of healthy adults and HIV-seropositives. Lancet 1990;335:15989.[CrossRef][ISI][Medline]cancerlit;90286800
24 Weiss L, Chang K. Association of the Epstein-Barr virus with hematolymphoid neoplasia. Adv Anatomic Pathol 1996;3:115.
25 Sokal R, Rohlf F. Biometry: the principles and practice of statistics in biological research. 2nd ed. New York (NY): W. H. Freeman & Co.; 1981. p. 4278.
Manuscript received May 15, 2000; revised October 26, 2000; accepted November 8, 2000.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
H-J Delecluse, R Feederle, B O'Sullivan, and P Taniere Epstein Barr virus-associated tumours: an update for the attention of the working pathologist J. Clin. Pathol., December 1, 2007; 60(12): 1358 - 1364. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. G. Perrigoue, J. A. den Boon, A. Friedl, M. A. Newton, P. Ahlquist, and B. Sugden Lack of Association between EBV and Breast Carcinoma Cancer Epidemiol. Biomarkers Prev., April 1, 2005; 14(4): 809 - 814. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Glaser, J. L. Hsu, and M. L. Gulley Epstein-Barr Virus and Breast Cancer: State of the Evidence for Viral Carcinogenesis Cancer Epidemiol. Biomarkers Prev., May 1, 2004; 13(5): 688 - 697. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Huang, H. Chen, L. Hutt-Fletcher, R. F. Ambinder, and S. D. Hayward Lytic Viral Replication as a Contributor to the Detection of Epstein-Barr Virus in Breast Cancer J. Virol., December 15, 2003; 77(24): 13267 - 13274. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. zur Hausen, J. van Beek, E. Bloemena, F. J. ten Kate, C. J. L. M. Meijer, and A. J. C. van den Brule No role for Epstein-Barr virus in Dutch hepatocellular carcinoma: a study at the DNA, RNA and protein levels J. Gen. Virol., July 1, 2003; 84(7): 1863 - 1869. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. G. Murray, D. Lissauer, J. Junying, G. Davies, S. Moore, A. Bell, J. Timms, D. Rowlands, C. McConkey, G. M. Reynolds, et al. Reactivity with A Monoclonal Antibody to Epstein-Barr Virus (EBV) Nuclear Antigen 1 Defines a Subset of Aggressive Breast Cancers in the Absence of the EBV Genome Cancer Res., May 1, 2003; 63(9): 2338 - 2343. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Wong, J. S. Pagano, J. T. Schiller, S. S. Tevethia, N. Raab-Traub, and J. Gruber New Associations of Human Papillomavirus, Simian Virus 40, and Epstein-Barr Virus with Human Cancer J Natl Cancer Inst, December 18, 2002; 94(24): 1832 - 1836. [Full Text] [PDF] |
||||
![]() |
A. Angeloni, A. Farina, G. Gentile, A. Capobianchi, P. Martino, V. Visco, R. Muraro, L. Frati, and A. Faggioni Epstein-Barr Virus and Breast Cancer: Search for Antibodies to the Novel BFRF1 Protein in Sera of Breast Cancer Patients J Natl Cancer Inst, April 4, 2001; 93(7): 560 - 561. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||






