© 2001 by Oxford University Press
Journal of the National Cancer Institute, Vol. 93, No. 15, 1147-1152,
August 1, 2001
© 2001 Oxford University Press
REPORT |
Molecular Evidence for the Independent Origin of Extra-ovarian Papillary Serous Tumors of Low Malignant Potential
Affiliations of authors: J. Gu, L. M. Roth, C. Younger, H. Michael, S. Zhang, T. M. Ulbright, J. N. Eble, L. Cheng, Department of Pathology and Laboratory Medicine, Indiana University School of Medicine, Indianapolis; F. W. Abdul-Karim, Case Western Reserve University School of Medicine, Cleveland, OH.
Correspondence to: Liang Cheng, M.D., Department of Pathology and Laboratory Medicine, Indiana University Medical Center, University Hospital 3465, 550 N. University Blvd., Indianapolis, IN 46202 (e-mail: lcheng{at}iupui.edu).
| ABSTRACT |
|---|
|
|
|---|
Background: Molecular data suggest that peritoneal tumors in women with advanced-stage ovarian papillary serous adenocarcinoma are monoclonal in origin. Whether the same is true for ovarian tumors of low malignant potential is not known. We compared peritoneal and ovarian tumors from women with advanced-stage ovarian papillary serous tumors of low malignant potential to determine whether the peritoneal tumors arose from the same clone as the ovarian tumors. Methods: We studied the clonality of 73 peritoneal and ovarian tumors from 18 women with advanced-stage ovarian papillary serous tumors of low malignant potential. Formalin-fixed, paraffin-embedded tumors and representative normal tissues were sectioned and stained with hematoxylineosin, representative sections from separate tumors were manually microdissected, genomic DNA was extracted from the microdissected tumors, and the polymerase chain reaction was used to amplify a CAG polymorphic site in the human androgen receptor locus on the X chromosome to determine the inactivation pattern of the X chromosome and the clonality of the tumors. Results: The pattern of X-chromosome inactivation could be determined from the tumors of 13 of 18 patients. Of the 13 patients, seven (54%) had nonrandom inactivation of the X chromosome, and six of the seven had different inactivation patterns in the peritoneal and ovarian tumors. Three of these patients also had different patterns of nonrandom X-chromosome inactivation in tumors from each ovary. The remaining six patients had random patterns of X-chromosome inactivation in the peritoneal and ovarian tumors. Conclusions: Our data suggest that peritoneal and ovarian tumors of low malignant potential arise independently.
| INTRODUCTION |
|---|
|
|
|---|
Epithelial ovarian tumors of low malignant potential, also known as borderline tumors, account for approximately 15% of all epithelial ovarian cancers. These tumors, characterized by a proliferation of epithelial cells forming papillary projections or tufts, lack stromal invasion. Patients with ovarian tumors of low malignant potential may have peritoneal tumors that are morphologically identical to the primary ovarian tumors. However, studies (14) have suggested that the presence of these peritoneal tumors does not imply a poor patient prognosis unless the tumors have an invasive growth pattern. Indeed, the 5-year survival rate for patients with ovarian tumors of low malignant potential is greater than 90%, compared with approximately 30% for patients with invasive ovarian cancers.
Although ovarian tumors of low malignant potential and the associated peritoneal tumors are often similar histologically, it is unknown whether the ovarian and peritoneal tumors are of common origin (i.e., arise from the same neoplastic clone). Several studies (57) have addressed the clonality of advanced-stage ovarian carcinomas and found these tumors to be monoclonal at ovarian and extra-ovarian sites. By contrast, papillary serous carcinomas of the peritoneum have been shown to be multifocal in origin (8). Understanding the clonal origin of peritoneal tumors in patients with ovarian tumors of low malignant potential may have important biologic and clinical implications for tumor prevention, tumor classification, and treatment.
The clonality of a tumor can be determined by X-chromosome-linked and non-X-chromosome-linked analysis, such as loss of heterozygosity (LOH), gene rearrangements, and point mutations. The most consistent informative marker of the clonal composition of neoplastic and preneoplastic disorders in women is the cellular pattern of X-chromosome inactivation. In women, normal somatic cells contain two X chromosomes, one of which is inactivated during early embryogenesis. X-chromosome inactivation occurs randomly and results in somatic mosaicism in normal tissues, with an equal mix of cells inactivating the X chromosome of either maternal or paternal origin. Throughout the life of the cell, the same maternal or paternal X chromosome will be inactivated in any subsequent cell division. Because the fidelity of the X-chromosome inactivation is retained, if the ovarian and peritoneal tumors arise from the same neoplastic clone, they should have identical inactive X chromosomes. Identical patterns of nonrandom X-chromosome inactivation would, therefore, suggest that the ovarian and peritoneal tumors are monoclonal in origin, implying that the peritoneal tumors metastasized from the primary ovarian tumor. Different patterns of nonrandom X-chromosome inactivation would suggest that the tumors are independent in origin.
Although there are several methods for assessing X-chromosome inactivation, such as X-linked DNA polymorphism of hypoxanthine phosphoribosyl transferase (HPRT) or phosphoglycerate kinase, etc., we took advantage of the polymorphic CAG repeats near the methylation-sensitive sites of the HhaI restriction endonuclease in exon 1 of the androgen receptor (AR) gene, located in chromosome Xq1112 (9,10). The frequency of genetic polymorphism for the human AR gene is more than 90%, compared with 29% for that of the HPRT gene. The methylation status of the HhaI restriction endonuclease site corresponds with the inactivation status of the X chromosome and thus allows for the distinction between the active and inactive X chromosomes. In this report, we assessed whether ovarian and peritoneal tumors of low malignant potential were of common origin.
| PATIENTS AND METHODS |
|---|
|
|
|---|
Patients
Eighteen women, ranging in age from 18 to 86 years, were diagnosed with advanced-stage ovarian papillary serous tumors of low malignant potential and underwent staging laparotomies and resection of the ovaries and extra-ovarian tumor sites at Indiana University Hospitals and University Hospitals of Cleveland from 1991 to 1999. All samples were procured after obtaining a signed informed consent form in accordance with the Institutional Committee for the Protection of Human Subjects. All patients had both ovarian and peritoneal papillary serous tumors of low malignant potential. All tumors were staged according to the criteria of the International Federation of Gynecology and Obstetrics for ovarian carcinoma (11). None of the tumors in our series had a micropapillary pattern (12). Such tumors have also been referred to as micropapillary serous carcinoma by some investigators (13).
Tumor Samples and Microdissection
Histologic sections were prepared from formalin-fixed, paraffin-embedded blocks and stained with hematoxylineosin for histopathologic review and the X-chromosome inactivation analysis. In total, 73 separate tumors were obtained from the 18 patients. Tumors were obtained from both ovarian and peritoneal sites for each patient. One control sample (i.e., not involved with the tumor) was obtained from the normal stromal tissue for each patient.
Tumors were microdissected from serial sections as described previously (14,15). Briefly, cells of interest were selected under direct light microscopic visualization (Olympus, Tokyo, Japan) and gently scraped with the use of a sterile 28-gauge needle until the selected cells were detached from the deparaffinized slides. The cells were then picked up by the needle and transferred into a single-step extraction buffer (see below). Approximately 400600 cells were microdissected per sample. For examples of tumor sections before and after microdissection, see Fig. 1
.
|
Detection of X-Chromosome Inactivation
DNA samples were prepared from distinctly separate tumors from the same patient. The dissected cells were placed in 15 µL of buffer (i.e., 10 mM TrisHCl, 1 mM EDTA, 1% Tween 20, and 0.2 mg/mL of proteinase K [pH 8.3]) and incubated overnight at 37 °C (14,15). The solution was boiled for 10 minutes to inactivate the proteinase K and used directly for subsequent clonal analysis without further purification. Aliquots (8 µL) of the DNA extract were digested overnight at 37 °C with 1 U of HhaI restriction endonuclease (New England Biolabs Inc., Beverly, MA) in a total volume of 10 µL. Equivalent aliquots of the DNA extracts were also incubated in the digestion buffer without HhaI endonuclease as control reactions for each sample. After the incubation, 3 µL of digested or nondigested DNA was amplified in a 25-µL polymerase chain reaction (PCR) volume containing 0.1 µL 32[P]
-labeled deoxyadenosine triphosphate (dATP) (3000 Ci/mmol), 4 µM AR-sense primer (5' TCCAGAATCTGTTCCAGAGCGTGC3'), 4 µM AR-antisense primer (5'GCTGTGAAGGTTGCTGTTCCTCAT3') (9), 4% dimethyl sulfoxide, 2.5 mM MgCl2, 300 µM deoxycytidine triphosphate, 300 µM deoxythymidine triphosphate, 300 µM deoxyguanosine triphosphate, 300 µM dATP, and 0.13 U Taq DNA polymerase (Perkin-Elmer Corp., Norwalk, CT). Each PCR amplification had an initial denaturation step of 95 °C for 8 minutes, followed by 32 cycles at 95 °C for 40 seconds, at 63 °C for 40 seconds, and at 72 °C for 60 seconds and then followed by a single final extension step at 72 °C for 10 minutes. The PCR products were then diluted with 4 µL of loading buffer containing 95% formamide, 20 mM EDTA, 0.05% bromphenol blue, and 0.05% xylene cyanole FF (Sigma Chemical Co., St. Louis, MO). The samples were heated to 95 °C for 5 minutes and then placed on ice. Three microliters of the reaction mixture was loaded onto 6.5% polyacrylamide-denaturing gels without formamide, and the PCR products were separated by electrophoresis at 1600 V for 47 hours. The bands were visualized after autoradiography with Kodak X-OMAT AR film (Eastman Kodak Company, Rochester, NY) for 816 hours.
Analysis of X-Chromosome Inactivation
The cases were considered to be informative if two AR allelic bands were detected after PCR amplification in normal control samples that had not been treated with HhaI. Only informative cases (i.e., those without a skewed pattern of X-chromosome inactivation after being treated with HhaI in normal control samples) were included in the analysis. In tumor samples, nonrandom X-chromosome inactivation was defined as a complete or a nearly complete absence of an AR allele after HhaI digestion, which indicated a predominance of one allele (1618).
Tumors were considered to be monoclonal if the same AR allelic inactivation pattern was detected in different tumors from the same patient (see Fig. 2
, Pattern X). Tumors were considered to be multiclonal if alternate predominance of AR alleles after HhaI digestion (different allelic inactivation patterns) was detected in different tumors from the same patient. Tumors with different allelic inactivation patterns were considered to be of independent origin (see Fig. 2
, Pattern Y).
|
| RESULTS |
|---|
|
|
|---|
To determine the origin of peritoneal and ovarian tumors of low malignant potential, we assessed X-chromosome inactivation in 73 separate tumor samples from 18 patients. All patients had papillary serous ovarian tumors of low malignant potential with extra-ovarian site involvement (Table 1
|
In the tumors from five of 18 patients (cases 6, 7, 11, 14, and 16), the patterns of X-chromosome inactivation for all sites were noninformative. Of the remaining 13 informative cases, six (cases 2, 3, 5, 10, 13, and 18) showed random inactivation of the X chromosome, with two allelic bands present after digestion with HhaI; six (cases 1, 8, 9, 12, 15, and 17) had different nonrandom X-chromosome-inactivation patterns in the ovarian and peritoneal tumors (Fig. 3
|
| DISCUSSION |
|---|
|
|
|---|
The monoclonal origin of advanced epithelial ovarian carcinomas and their concurrent metastatic tumors is well documented (57,19). Jacobs et al. (20) analyzed LOH, p53 mutations, and X-chromosome inactivation status and found that tumors from multiple sites in patients with advanced serous ovarian carcinoma were monoclonal in origin. However, whether the peritoneal tumors in cases of ovarian papillary serous tumor of low malignant potential arise as multiple primary tumors or through the metastatic spread from primary ovarian tumors is unknown. We used exon 1 of the AR gene in chromosome Xq1112 for the detection of nonrandom X-chromosome inactivation. This particular exon was chosen because of a highly polymorphic marker, the CAGnucleotide repeat, and the methylation-sensitive restriction endonuclease HhaI sites close to the CAG repeat (9). We detected nonrandom X-chromosome inactivation in seven (54%) of 13 informative cases, indicating that these tumors were derived clonally. We detected different patterns of nonrandom X-chromosome inactivation in the ovarian and peritoneal tumors in six cases, suggesting that these tumors were derived independently. Furthermore, three cases had different patterns of nonrandom X-chromosome inactivation in tumors derived from contralateral ovaries. These data indicate that the multiple ovarian tumors of low malignant potential from different sites arise independently in some patients, supporting the "field effect" hypothesis of ovarian tumorigenesis (21).
There are several striking differences between ovarian tumors of low malignant potential and ovarian carcinomas. For example, in contrast to ovarian carcinomas, ovarian tumors of low malignant potential lack destructive stromal invasion (7,22, 23). LOH or microsatellite instability (24,25) and p53 mutations are uncommon in ovarian tumors of low malignant potential (26). In addition, K-ras mutations are more common in ovarian tumors of low malignant potential than in ovarian carcinomas (26,27). Although these characteristics may, in part, be responsible for the better prognosis and 5-year survival rate for women diagnosed with ovarian tumors of low malignant potential (1,2833), they suggest that ovarian carcinomas and ovarian tumors of low malignant potential might arise through different mechanisms of carcinogenesis (24,25).
Several theories have been put forth to explain the clonality of ovarian cancers. In the monoclonal theory of carcinogenesis, a single malignant cell expands clonally to form a primary malignancy and its metastases. However, the monoclonal model of carcinogenesis cannot easily explain the clinical observations of multifocal, synchronous, or metachronous tumors in the ovaries. Therefore, other models that consider field effect have evolved. During ovarian carcinogenesis, a field effect may promote the independent transformation of epithelial cells at different locations. Indeed, Buller et al. (21) proposed that multiple recurrent tumors arose de novo and were different clonally from primary ovarian tumors. An alternative theory, suggested by Segal and Hart (34), was based on the observation that most patients with advanced serous borderline tumors had ovarian cortical surface involvement. Segal and Hart (34) proposed that neoplastic epithelial cells become detached from the papillary excrescences growing on the external surfaces of the ovary and subsequently implant on the peritoneum, omentum, and serosal surfaces of other visceral organs, resulting in multifocal disease (34). However, earlier, Russell (23) argued that peritoneal tumors are not truly metastatic in nature but arise independently (in situ) in response to the same tumorigenic agents that are responsible for the ovarian tumors.
Approximately 30%40% of patients with serous ovarian tumors of low malignant potential have bilateral or multifocal lesions at the time of diagnosis (28,29, 31,32,35). Determining the clonal origin of peritoneal and bilateral ovarian tumors of low malignant potential may have important biologic and clinical implications. Multiple tumors that originate from a single tumor clone through metastasis may indicate an aggressive clinical course and thus warrant the designation of a higher tumor stage. On the other hand, tumors arising independently in the peritoneum would not necessarily have the same clinical relevance. In this study, we found that tumor samples from the left and right ovaries showed different patterns of nonrandom X-chromosome inactivation, suggesting that bilateral ovarian tumors of low malignant potential arise independently from different clones. In some cases, tumor samples from the ovaries and peritoneum showed different patterns of nonrandom X-chromosome inactivation. These results suggest that the peritoneal tumors in patients with multifocal ovarian tumors of low malignant potential are of independent origin. Lu et al. (16) hypothesized that peritoneal tumors in patients with ovarian tumors of low malignant potential may be independent early papillary serous tumors of the peritoneum, which have been shown to have a multiclonal origin (8). Because data suggest that some peritoneal tumors in advanced-stage ovarian serous tumors of low malignant potential are derived from different clones than those that give rise to the ovarian tumors, the designation of peritoneal tumors as "implants" may not be appropriate. So-called invasive implants may actually represent primary peritoneal carcinomas. It is of interest to note that, in case 17, the invasive implants in the peritoneal tumors had a different nonrandom pattern of X-chromosome inactivation than that of the ovarian tumors, indicating the polyclonal origin of these tumors. Furthermore, the different pattern of nonrandom X-chromosome inactivation observed in different peritoneal tumors, as in case 12, strongly suggests that these peritoneal tumors arise independently as a result of a field effect.
The incidence of nonrandom X-chromosome inactivation (54%) in the current study is higher than reported previously (36). This difference may be explained by the methods of sample collection and the different types of malignancy studied. For example, we used tissue microdissection for the procurement of the DNA samples, and none of our patients had invasive ovarian cancer.
In summary, we used X-chromosome inactivation to determine the clonality of advanced-stage papillary serous ovarian tumors of low malignant potential. Some patients with bilateral ovarian tumors of low malignant potential had two primary tumors instead of one ovarian tumor with metastases to the other ovary. Our results indicate that the peritoneal tumors associated with ovarian tumors of low malignant potential may arise independently from their own primary tumor clones.
| REFERENCES |
|---|
|
|
|---|
1 Kennedy AW, Hart WR. Ovarian papillary serous tumors of low malignant potential (serous borderline tumors). A long-term follow-up study, including patient with microinvasion, lymph node metastasis, and transformation to invasive serous carcinoma. Cancer 1996;78:27886.[CrossRef][Web of Science][Medline]cancerlit;96284295
2 Bostwick DG, Tazelaar HD, Ballon SC, Hendrickson MR, Kempson RL. Ovarian epithelial tumors of borderline malignancy. A clinical and pathologic study of 109 cases. Cancer 1986;58:205265.[CrossRef][Web of Science][Medline]cancerlit;87001981
3 Michael H, Roth LM. Invasive and noninvasive implants in ovarian serous tumors of low malignant potential. Cancer 1986;57:12407.[CrossRef][Web of Science][Medline]cancerlit;86105766
4 Bell DA, Weinstock MA, Scully RE. Peritoneal implants of ovarian serous borderline tumors. Histologic features and prognosis. Cancer 1988;62:221222.[CrossRef][Web of Science][Medline]cancerlit;89028103
5 Tsao SW, Mok CH, Knapp RC, Oike K, Muto MG, Welch WR, et al. Molecular genetic evidence of a unifocal origin for human serous ovarian carcinomas. Gynecol Oncol 1993;48:510.[CrossRef][Web of Science][Medline]cancerlit;93138475
6
Mok CH, Tsao SW, Knapp RC, Fishbaugh PM, Lau CC. Unifocal origin of advanced human epithelial ovarian cancers. Cancer Res 1992;52:511922.
7 Kupryjanczyk J, Thor AD, Beauchamp R, Poremba C, Scully RE, Yandell DW. Ovarian, peritoneal, and endometrial serous carcinoma: clonal origin of multifocal disease. Mod Pathol 1996;9:16673.[Web of Science][Medline]cancerlit;96265537
8
Muto MG, Welch WR, Mok SC, Bandera CA, Fishbaugh PM, Tsao S, et al. Evidence for a multifocal origin of papillary serous carcinoma of the peritoneum. Cancer Res 1995;55:4902.
9 Allen RC, Zoghbi HY, Moseley AB, Rosenblatt HM, Belmont JW. Methylation of HpaII and HhaI sites near the polymorphic CAG repeat in the human androgen-receptor gene correlates with X chromosome inactivation. Am J Hum Genet 1992;51:122939.[Web of Science][Medline]
10
Tilley WD, Marcelli M, Wilson JD, McPhaul MJ. Characterization and expression of a cDNA encoding the human androgen receptor. Proc Natl Acad Sci U S A 1989;86:32731.
11 International Federation of Gynecology and Obstetrics. Classification and staging of malignant tumours in the female pelvis. Acta Obstet Gynecol Scand 1971;50:17.[Medline]
12 Eichhorn JH, Bell DA, Young RH, Scully RE. Ovarian serous borderline tumors with micropapillary and cribriform patterns: a study of 40 cases and comparison with 44 cases without these patterns. Am J Surg Pathol 1999;23:397409.[CrossRef][Web of Science][Medline]cancerlit;99213561
13 Burks RT, Sherman ME, Kurman RJ. Micropapillary serous carcinoma of the ovary. A distinctive low-grade carcinoma related to serous borderline tumors. Am J Surg Pathol 1996;20:131930.[CrossRef][Web of Science][Medline]cancerlit;97054539
14 Zhuang Z, Bertheau P, Emmert-Buck MR, Liotta LA, Gnarra J, Linehan WM, et al. A microdissection technique for archival DNA analysis of specific cell population in lesions <1 mm in size. Am J Pathol 1995;146: 6205.[Abstract]cancerlit;95193819
15
Zhuang Z, Merino MJ, Chuaqui R, Liotta LA, Emmert-Buck MR. Identical allelic loss on chromosome 11q13 in microdissected in situ and invasive human breast cancer. Cancer Res 1995;55:46771.
16
Lu KH, Bell DA, Welch WR, Berkowitz RS, Mok SC. Evidence for the multifocal origin of bilateral and advanced human serous borderline ovarian tumors. Cancer Res 1998;58:232830.
17
Cheng L, Song SY, Pretlow TG, Abdul-Karim FW, Kung HJ, Dawson DV, et al. Evidence of independent origin of multiple tumors from patients with prostate cancer. J Natl Cancer Inst 1998;90:2337.
18
Cheng L, Shan A, Cheville JC, Qian J, Bostwick DG. Atypical adenomatous hyperplasia of the prostate: a premalignant lesion? Cancer Res 1998;58:38991.
19 Pejovic T, Heim S, Mandahl N, Elmfors B, Furgyik S, Floderus UM, et al. Bilateral ovarian carcinoma: cytogenetic evidence of unicentric origin. Int J Cancer 1991;47:35861.[Web of Science][Medline]cancerlit;91131196
20
Jacobs IJ, Kohler MF, Wiseman RW, Marks JR, Whitaker R, Kerns BA, et al. Clonal origin of epithelial ovarian carcinoma: analysis by loss of heterozygosity, p53 mutation, and X-chromosome inactivation. J Natl Cancer Inst 1992;84:17938.
21 Buller RE, Skilling JS, Sood AK, Plaxe S, Baergen RN, Lager DJ. Field cancerization: why late "recurrent" ovarian cancer is not recurrent. Am J Obstet Gynecol 1998;178:6419.[CrossRef][Web of Science][Medline]cancerlit;98239028
22 Scully RE. Ovarian tumors: a review. Am J Pathol 1977;87:686720.[Web of Science][Medline]
23 Russell P. The pathological assessment of ovarian neoplasms. I: Introduction to the common "epithelial" tumours and analysis of benign epithelial tumours. Pathology 1979;11:526.[Web of Science][Medline]cancerlit;79617843
24
Cheng PC, Gosewehr JA, Kim TM, Velicescu M, Wan M, Zheng J, et al. Potential role of the inactivated X chromosome in ovarian epithelial tumor development. J Natl Cancer Inst 1996;88:5108.
25 Shih YC, Kerr J, Hurst TG, Khoo SK, Ward BG, Chenevix-Trench G. No evidence for microsatellite instability from allelotype analysis of benign and low malignant potential ovarian neoplasms. Gynecol Oncol 1998;69:2103.[CrossRef][Web of Science][Medline]cancerlit;98312395
26
Teneriello MG, Ebina M, Linnoila RI, Henry M, Nash JD, Park RC, et al. p53 and Ki-ras gene mutations in epithelial ovarian neoplasms. Cancer Res 1993;53:31038.
27
Mok SC, Bell DA, Knapp RC, Fishbaugh PM, Welch WR, Muto MG, et al. Mutation of K-ras protooncogene in human ovarian epithelial tumors of borderline malignancy. Cancer Res 1993;53:148992.
28 Rice LW, Berkowitz RS, Mark SD, Yavner DL, Lage JM. Epithelial ovarian tumors of borderline malignancy. Gynecol Oncol 1990;39:1958.[CrossRef][Web of Science][Medline]cancerlit;91033261
29 Link CJ Jr, Reed E, Sarosy G, Kohn EC. Borderline ovarian tumors. Am J Med 1996;101:21725.[CrossRef][Web of Science][Medline]cancerlit;96346112
30 Nikrui N. Survey of clinical behavior of patients with borderline epithelial tumors of the ovary. Gynecol Oncol 1981;12:10719.[CrossRef][Web of Science][Medline]cancerlit;82005310
31 Massad LS Jr, Hunter VJ, Szpak CA, Clarke-Pearson DL, Creasman WT. Epithelial ovarian tumors of low malignant potential. Obstet Gynecol 1991;78:102732.[Web of Science][Medline]cancerlit;92050561
32 Leake JF, Currie JL, Rosenshein NB, Woodruff JD. Long-term follow-up of serous ovarian tumors of low malignant potential. Gynecol Oncol 1992;47:1508.[CrossRef][Web of Science][Medline]cancerlit;93106490
33 Kurman RJ, Trimble CL. The behavior of serous tumors of low malignant potential: are they ever malignant? Int J Gynecol Pathol 1993;12:1207.[Web of Science][Medline]cancerlit;93216365
34 Segal GH, Hart WR. Ovarian serous tumors of low malignant potential (serous borderline tumors). The relationship of exophytic surface tumor to peritoneal "implants." Am J Surg Pathol 1992;16:57783.[Web of Science][Medline]cancerlit;92286426
35 Chambers JT, Merino MJ, Kohorn EI, Schwartz PE. Borderline ovarian carcinoma. Am J Obstet Gynecol 1988;159:108894.[Web of Science][Medline]cancerlit;89047601
36
Buller RE, Sood AK, Lallas T, Buekers T, Skilling JS. Association between nonrandom X-chromosome inactivation and BRCA1 mutation in germline DNA of patients with ovarian cancer. J Natl Cancer Inst 1999;91:33946.
Manuscript received February 9, 2001; revised May 28, 2001; accepted June 4, 2001.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
X. Wang, M. Wang, G. T. MacLennan, F. W. Abdul-Karim, J. N. Eble, T. D. Jones, F. Olobatuyi, R. Eisenberg, O. W. Cummings, S. Zhang, et al. Evidence for Common Clonal Origin of Multifocal Lung Cancers J Natl Cancer Inst, April 15, 2009; 101(8): 560 - 570. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Cheng, G. T. MacLennan, S. Zhang, M. Wang, M. Zhou, P.-H. Tan, S. Foster, A. Lopez-Beltran, and R. Montironi Evidence for Polyclonal Origin of Multifocal Clear Cell Renal Cell Carcinoma Clin. Cancer Res., December 15, 2008; 14(24): 8087 - 8093. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Katona, T. D. Jones, M. Wang, F. W. Abdul-Karim, O. W. Cummings, and L. Cheng Molecular Evidence for Independent Origin of Multifocal Neuroendocrine Tumors of the Enteropancreatic Axis. Cancer Res., May 1, 2006; 66(9): 4936 - 4942. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. P. McCarthy, M. Wang, T. D. Jones, R. W. Strate, and L. Cheng Molecular Evidence for the Same Clonal Origin of Multifocal Papillary Thyroid Carcinomas Clin. Cancer Res., April 15, 2006; 12(8): 2414 - 2418. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. D. Jones, J. N. Eble, M. Wang, G. T. MacLennan, B. Delahunt, M. Brunelli, G. Martignoni, A. Lopez-Beltran, S. M. Bonsib, T. M. Ulbright, et al. Molecular Genetic Evidence for the Independent Origin of Multifocal Papillary Tumors in Patients with Papillary Renal Cell Carcinomas Clin. Cancer Res., October 15, 2005; 11(20): 7226 - 7233. [Abstract] [Full Text] [PDF] |
||||
![]() |
I.-M. Shih and R. J. Kurman Molecular Pathogenesis of Ovarian Borderline Tumors: New Insights and Old Challenges Clin. Cancer Res., October 15, 2005; 11(20): 7273 - 7279. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. D. Jones, M. Wang, J. N. Eble, G. T. MacLennan, A. Lopez-Beltran, S. Zhang, A. Cocco, and L. Cheng Molecular Evidence Supporting Field Effect in Urothelial Carcinogenesis Clin. Cancer Res., September 15, 2005; 11(18): 6512 - 6519. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Cheng, T. D. Jones, R. P. McCarthy, J. N. Eble, M. Wang, G. T. MacLennan, A. Lopez-Beltran, X. J. Yang, M. O. Koch, S. Zhang, et al. Molecular Genetic Evidence for a Common Clonal Origin of Urinary Bladder Small Cell Carcinoma and Coexisting Urothelial Carcinoma Am. J. Pathol., May 1, 2005; 166(5): 1533 - 1539. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. X. Liang, S. K. Chambers, L. Cheng, S. Zhang, Y. Zhou, and W. Zheng Endometrial Glandular Dysplasia: A Putative Precursor Lesion of Uterine Papillary Serous Carcinoma. Part II: Molecular Features International Journal of Surgical Pathology, October 1, 2004; 12(4): 319 - 331. [Abstract] [PDF] |
||||
![]() |
R. P. McCarthy, S. Zhang, D. G. Bostwick, J. Qian, J. N. Eble, M. Wang, H. Lin, and L. Cheng Molecular Genetic Evidence for Different Clonal Origins of Epithelial and Stromal Components of Phyllodes Tumor of the Prostate Am. J. Pathol., October 1, 2004; 165(4): 1395 - 1400. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Kernek, T. M. Ulbright, S. Zhang, S. D. Billings, O. W. Cummings, J. D. Henley, H. Michael, M. Brunelli, G. Martignoni, R. S. Foster, et al. Identical Allelic Losses in Mature Teratoma and Other Histologic Components of Malignant Mixed Germ Cell Tumors of the Testis Am. J. Pathol., December 1, 2003; 163(6): 2477 - 2484. [Abstract] [Full Text] |
||||
![]() |
P. Morice, A. Thoury, J.C. Sabourin, S. Camatte, D. Atallah, J.P. Armand, P. Madelenat, P. Duvillard, and D. Castaigne Unusual Abdominal and Pelvic Tumors: CASE 2. SPONTANEOUS REGRESSION OF PERITONEAL IMPLANTS IN BORDERLINE OVARIAN TUMOR AFTER SALPINGO-OOPHORECTOMY J. Clin. Oncol., September 15, 2003; 21(18): 3536 - 3538. [Full Text] [PDF] |
||||
![]() |
N. L.G. Sieben, S. M. Kolkman-Uljee, A. M. Flanagan, S. le Cessie, A.-M. Cleton-Jansen, C. J. Cornelisse, and G. J. Fleuren Molecular Genetic Evidence for Monoclonal Origin of Bilateral Ovarian Serous Borderline Tumors Am. J. Pathol., April 1, 2003; 162(4): 1095 - 1101. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. J. Gardner and M. J. Birrer Ovarian Tumors of Low Malignant Potential: Can Molecular Biology Solve This Enigma? J Natl Cancer Inst, August 1, 2001; 93(15): 1122 - 1123. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||








