Skip Navigation

JNCI Journal of the National Cancer Institute 2000 92(22):1841-1847; doi:10.1093/jnci/92.22.1841
© 2000 by Oxford University Press
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Request Permissions
Google Scholar
Right arrow Articles by Soufir, N.
Right arrow Articles by Basset-Seguin, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Soufir, N.
Right arrow Articles by Basset-Seguin, N.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Journal of the National Cancer Institute, Vol. 92, No. 22, 1841-1847, November 15, 2000
© 2000 Oxford University Press


REPORT

Association Between INK4a-ARF and p53 Mutations in Skin Carcinomas of Xeroderma Pigmentosum Patients

Nadem Soufir, Leela Daya-Grosjean, Pauline de La Salmonière, Jean-Pierre Moles, Louis Dubertret, Alain Sarasin, Nicole Basset-Seguin

Affiliations of authors: N. Soufir, L. Dubertret, N. Basset-Seguin (Institut de Recherche sur la Peau, Institut National de la Santé et de la Recherche Medicale [INSERM] U532), P. de La Salmonière (Département de Biostatistique et Informatique Médicale), Hôpital Saint-Louis, Paris, France; L. Daya-Grosjean, A. Sarasin, Molecular Genetics Laboratory, UPR42, Centre National de la Recherche Scientifique, Villejuif, France; J.-P. Moles, Laboratoire de Dermatologie Moléculaire, Institut Universitaire de Recherche Clinique, Montpellier, France.

Correspondence to: Nicole Basset-Seguin, M.D., Ph.D., Institut de Recherche sur la Peau, INSERM U532, Pavillon Bazin, Hôpital Saint-Louis, 1, avenue Claude Vellefaux, 75010 Paris, France (e-mail: nbs{at}chu.st-louis.fr).


    ABSTRACT
 Top
 Notes
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Background: The INK4a-ARF locus encodes two tumor suppressor proteins, p16INK4a and p14ARF, that act through the Rb-CDK4 and p53 pathways, respectively. Data from murine models and sporadic human skin carcinomas implicate p16INK4a and p14ARF in the development of skin carcinomas. We examined the frequency of INK4a-ARF, p53, and CDK4 mutations in skin carcinomas from patients with xeroderma pigmentosum (XP), a rare autosomal disease that is associated with a defect in DNA repair and that predisposes patients to skin cancer. Methods: DNA from skin cancers of 28 unrelated XP patients was screened for mutations in p53, INK4a-ARF, and CDK4 coding exons by single-strand conformation polymorphism analysis and automated sequencing. Data were evaluated with the use of the exact unconditional test derived from Fisher's test. All statistical tests were two-sided. Results: Eight of 28 XP-associated tumors had mutations in the INK4a-ARF locus. Three XP-associated tumors had multiple mutations at this locus. In all, 13 mutations in the INK4a-ARF locus were detected in XP-associated tumors, of which seven (54%) were signature UV radiation-induced mutations, i.e., tandem CC : GG->TT : AA transitions. p53 mutations, mostly of the type induced by UV radiation, were present in 12 tumors (43%). Statistically significant positive associations were found between the frequency of mutations in p53 and in p16INK4a (P = .008) and between the frequency of mutations in p53 and in p14ARF (P<.001). No mutations were detected within the CDK4 gene. Conclusions: We have demonstrated for the first time the occurrence of UV radiation-induced mutations in INK4a-ARF in XP-associated skin carcinomas. The simultaneous inactivation of p53 and INK4a-ARF may be linked to the genetic instability caused by XP and could be advantageous for tumor progression.



    INTRODUCTION
 Top
 Notes
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Xeroderma pigmentosum (XP) is a rare autosomal recessive disorder that is associated with a germline nucleotide excision repair defect (1). This defect prevents removal of a wide array of DNA lesions, such as cyclobutane pyrimidine dimers and (6,4)-pyrimidine-pyrimidone photoproducts, both of which are produced in human skin by solar UV radiation. XP patients exhibit extreme sensitivity to sunlight and have a 4000-fold increased frequency of sunlight-induced skin cancers, including basal cell carcinoma (BCC), squamous cell carcinoma (SCC), and melanoma (2). Among the genetic abnormalities that have been characterized in BCCs and SCCs from XP patients, UV radiation-induced p53 mutations are the most common (86%) (3,4). In addition, mutations in other genes may also contribute to oncogenic transformation in XP-associated cancers. Activating ras mutations are present in 30% of XP-associated skin carcinomas (5), and UV radiation-induced patched mutations have been detected in 73% of BCCs from XP patients (6).

There is also evidence that mutations in the INK4a-ARF locus, which maps to chromosome 9p21, may contribute to the development of skin carcinomas. For example, loss of heterozygosity and homozygous deletions encompassing the INK4a-ARF locus are common in SCC cell lines and in SCCs themselves (710). Moreover, targeted disruption of the entire INK4a-ARF locus or of p19ARF (the murine homologue of p14ARF) renders mice susceptible to SCC (11,12). Furthermore, there is substantial evidence that the two proteins encoded by alternative transcripts of the INK4a-ARF locus, p16INK4a (exons 1{alpha}, 2, and 3) and p14ARF (exons 1{beta}, 2, and 3; Fig. 1Go), are critical in regulating cell proliferation (7,8,1315).



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 1. The INK4a-ARF locus and a schematic of the interaction between p16INK4a and p14ARF proteins with cell cycle-regulatory pathways. (a) The p16INK4a/CDK4/pRb pathway. Cyclin-dependent kinase 4 (CDK4) negatively regulates retinoblastoma protein (pRb) activity by phosphorylation. p16INK4a inhibits CDK4 binding to cyclin D, therefore preventing inactivation of pRb. Hypophosphorylated pRb represses E2F-dependent genes, blocking G1/S cell cycle progression. Free E2F activates many genes involved in mitosis and p14ARF. (b) The p14ARF/p53 pathway. p53 is targeted by MDM2 for ubiquitination and degradation. In response to oncogenic signals, p14ARF induces MDM2 nucleolar relocalization, thereby preventing MDM2–p53 interactions and resulting in the stabilization of p53.

 
p16INK4a and p14ARF interact with the cell cycle-regulatory proteins pRb and p53, respectively (Fig. 1Go). p16INK4a is a cyclin-dependent kinase inhibitor that specifically inhibits progression through the G1 phase of the cell cycle in cells that express the retinoblastoma protein (pRb) (Fig. 1Go). p16INK4a maintains pRb in its activating state by blocking cyclin-dependent kinase 4 (CDK4) from phosphorylating pRb (16). p14ARF specifically activates the p53 pathway. p14ARF stabilizes p53 by inhibiting MDM2-dependent p53 degradation (17), thereby inducing cell cycle arrest or apoptosis, depending on the stimulus. Data have shown that p14ARF binds to MDM2 through an NH2-terminal domain encoded by exon 1{beta} (17), whereas a functional domain that is encoded by exon 2 is involved in the nucleolar localization of p14ARF (18). Activation of p14ARF (in response to an oncogenic signal such as c-myc, E1A, activated Ha-ras, or E2F1) leads to the localization and sequestration of MDM2 in the nucleolar compartment, thereby stabilizing p53 by preventing MDM2-p53 from undergoing ubiquitin-mediated degradation [reviewed in (19)].

By their interactions with pRb and p53, p16INK4a and p14ARF are important in regulating the proliferation of both normal and tumorigenic squamous epithelial cells. p16INK4a accumulates in normal keratinocytes undergoing replicative senescence and is inactivated during keratinocyte immortalization (7,8). Human squamous esophageal cancer cell lines and murine primary squamous epithelial cells show reduced proliferation following overexpression of p16INK4a, suggesting that squamous cells are sensitive to a growth-regulatory pathway that involves p16 and pRb (14). p16INK4a and p14ARF are also potent suppressors of proliferation in vitro of head and neck squamous carcinoma cells (15). Thus, p16INK4a is considered to be a key tumor suppressor gene, and its inactivation by deletions, mutations, or methylation can occur in a wide range of human cancers (20). Furthermore, p16INK4a accumulates in HeLa cells after nonlethal UV irradiation, suggesting that it may play a role in UV radiation-induced cell cycle arrest. Therefore, alteration in p16INK4a may constitute an important step in UV radiation-induced tumorigenesis (21).

We have recently reported the presence of UV radiation-induced mutations of the INK4a-ARF locus in 12% of human sporadic skin carcinomas (including 24% of SCCs and 3.5% of BCCs) (22). These INK4a-ARF mutations seemed to occur in the absence of p53 gene mutations, suggesting that they are independent events in the tumorigenic process (22). To gain insight into the role of the INK4a-ARF locus in skin carcinogenesis, we performed a mutational analysis of the p16INK4a, p14ARF, CDK4, and p53 genes in skin carcinomas from XP patients and compared our results with those previously found for sporadic tumors.


    SUBJECTS AND METHODS
 Top
 Notes
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Of the XP patients in this study, 90% were North African Caucasians from Algeria, Tunisia, or Morocco and 10% were French Caucasians. Skin biopsy specimens were taken from XP patients when possible, and the XP complementation group was determined either by somatic cell fusion analysis or by a recombinant retrovirus transfection procedure (23).

In XP, seven different complementation groups (A to G) have been identified; each corresponds to a deficiency in a distinct gene. In addition, a variant group (known as XP variant) has been characterized that is deficient in the mutagenic polymerase eta (24). Patients belonging to complementation group C have a defect in the repair of DNA lesions in the genome overall but are proficient in the repair of lesions present on the transcribed strand of active genes (3). Sixty percent of the patients in this study belonged to complementation group C. The complementation groups of the remaining patients are unknown, since skin biopsy specimens were not available (Table 1Go). All of our XP patients presented with typical clinical symptoms associated with XP, including pronounced photosensitivity, strong pigmentation of sun-exposed skin, and the development of skin cancers at an early age (before 10 years of age). The average age of the XP patients at the time of biopsy for the tumors analyzed in this study was 8 years.


View this table:
[in this window]
[in a new window]
 
Table 1. p16INK4a, p14ARF, and p53 mutations in 13 xeroderma pigmentosum (XP)-associated skin epithelial tumors*
 
Tumor Samples and DNA Extraction

Twenty-eight skin epithelial neoplasms from XP patients were collected after surgical resection. Tumors were divided into two parts. One part was snap-frozen in liquid nitrogen and stored at –80 °C. Tumor DNA was prepared from frozen tumor samples as described previously (5). The other part was fixed in formalin, embedded in paraffin, and assessed histopathologically. Of the 28 tumor samples, 18 were diagnosed as SCC and 10 were diagnosed as BCC.

Single-Strand Conformation Polymorphism Analysis

Single-strand conformation polymorphism (SSCP) analysis is a technique for the detection of mutations based on the three-dimensional conformation taken by a single-strand DNA in a nondenaturing environment (25). Coding sequences and flanking intronic sequences of exons 1{alpha}, 1{beta}, and 2 of the INK4a-ARF gene were analyzed by polymerase chain reaction (PCR)–SSCP. Primer sequences for exons 1{alpha} and 2 have been described previously (22,26). Exon 1{beta} was analyzed through two overlapping PCR products generated with the primer pairs P14F1 (5` TCAGGGAAGGGCGGGTGCG 3`) and P14R1 (5` GCCGCGGGATGTGAACCA 3`), which generated a 245-base-pair (bp) product, and the primer pair P14F2 (5` GCCGCGAGTGAGGGTTTT 3`) and P14R2 (5` CACCGCGGTTATCTCCTC 3`), which generated a 257-bp product. Coding and flanking intron sequences of exon 2 of the CDK4 gene, which include residues shown previously to be mutated in familial melanoma (26,27) or to affect p16INK4a binding (28), were amplified with the use of the primer pair CDK4F2 (5` AGCGACTTTTGGTGATAGGAGT 3`) and CDK4R2 (5` GGCTGTCTTTTCCCTTTACTC 3`) to generate a PCR product of 322 bp. Exons 4 through 9 of the p53 gene were amplified with the use of the primers and conditions as described previously (22). Each PCR reaction was performed in a volume of 20 µL with 50–100 ng of genomic DNA template, 30 pmol of each primer, 0.5 IU of Taq polymerase (Life Technologies, Inc. [GIBCO BRL], Rockville, MD), 0.1 µL of [{alpha}-33P]deoxycytidine triphosphate (Amersham Life Science, Inc., Arlington Heights, IL), and 1.5 mM MgCl2. All reactions were supplemented with 10% dimethyl sulfate. Annealing was performed at 60 °C for the three exons of the INK4a-ARF gene and at 55 °C for exons 4 through 9 of p53 and exon 2 of CDK4. PCR products were separated on each of two 0.1x Tris buffer EDTA/Hydrolink MDE gels (FMC BioProducts, Rockland, ME), either with 8% glycerol at room temperature or without glycerol at 4 °C. Gels were run at constant power (8 W) for 14 hours at room temperature or 12 hours at 4 °C, dried, and exposed to autoradiographic film. The entire procedure was repeated at least twice for each sample. Shifted bands were cut out of the gel and reamplified for sequencing. Products from 50-µL PCR reactions were purified with the use of a Microcon 100 (Amicon, Inc., Beverly, MA) and sequenced with the use of a dye-labeled terminator on an automated sequencer 373 (Applied Biosystems, Foster City, CA) according to the manufacturer's instructions. The transcribed strand is, by definition, the noncoding sequence. All of the coding and noncoding sequences are available in the sequence databases.

Statistical Methods

We used the exact unconditional test from Fisher's test (29) to evaluate the association between the occurrence of the mutations in p16INK4a, p14ARF, and p53 in XP-associated skin tumors and the distribution of INK4a-ARF mutations on the two strands (transcribed and nontranscribed) of the gene. We used the same test to compare several variables between XP and sporadic skin carcinomas, including 1) the frequency of tumors harboring p16INK4a or p14ARF mutations, 2) the frequency of the association of mutations in p53 and p16INK4a and in p53 and p14ARF, and 3) the number of tandem mutations in p53, INK4a-ARF, and in both genes. Sporadic skin tumors were studied previously (22,30,31). Two-sided tests were computed with the use of SAS software (SAS Institute, Cary, NC), and P values of <.05 were considered to be statistically significant.


    RESULTS
 Top
 Notes
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
In total, tumor DNAs from 28 unrelated XP patients were studied. Of the 28 tumors, 18 were SCCs and 10 were BCCs. Mutational analysis of the INK4a-ARF locus identified 13 mutations from eight tumors (Table 1Go). These mutations correspond to nine different nucleotide changes, three in exon 1{alpha} from p16INK4a and six in exon 2 (Table 1Go). Of the 18 SCCs, six (33%) had a total of 10 mutations; of the 10 BCCs, two (20%) had a total of three mutations. Three tumors (two SCCs and one BCC) harbored multiple mutations.

Seven mutations were tandem CC : GG->TT : AA transitions (54%), and five mutations were C : G->T : A transitions (38%), with four of the five occurring at dipyrimidic sites, which is indicative of the presence of unrepaired UV radiation-induced DNA lesions. The transcribed strand of the p16INK4a gene contains 125 dipyrimidic sites, compared with 94 on the nontranscribed strand. Two mutations occurred on the transcribed strand, and nine mutations occurred on the nontranscribed (82%) strand, reflecting preferential DNA repair of the transcribed strand (two of 125 dipyrimidic sites versus nine of 94; P = .009).

Of the 13 total mutations, seven had been described previously in various tumors (Table 1Go) (32,33). Notably, three different mutations, corresponding to amino acid changes Arg58Ter (termination), Arg80Ter, and Pro114Leu, occurred at known mutational hot spots (Table 1Go) (32,33). Four mutations from three tumors have not been reported previously: One was a C->T substitution in the 5` regulatory region, one was a G->{alpha} transition at nucleotide 79 that resulted in a missense mutation at codon 27, and one was a tandem CC : GG->TT : AA mutation at nucleotides 341–342 (Table 1Go).

All of the mutations affected p16INK4a. Twelve mutations were likely to be deleterious for p16INK4a function, either because of their nature (splicing, frameshift, or nonsense) in seven cases or their location at critical residues previously implicated in p16INK4a folding or function in five cases. In fact, these five were localized in one of the four ankyrin repeats, at an amino acid that is conserved between the murine and human p15INK4b and p16INK4a proteins (9) and known to affect p16INK4a binding affinity to CDK4 (34,35).

All tumors with mutations in p16INK4a also had mutations in p14ARF (Table 1Go). Because exon 2 is common to both p16INK4a and p14ARF, mutations in this exon might affect the p14ARF reading frame. Of the four p14ARF mutations observed in eight tumors (Table 1Go), three were missense mutations and one was a splicing mutation (Table 1Go). Two tumors had multiple mutations. Of the p14ARF missense mutations, two occurred at codons that correspond to amino acids that are conserved between human and mouse complementary DNA in six tumors and one occurred at a nonconserved amino acid in two tumors. All but one of the tumors harboring a mutated p16INK4a or p14ARF allele also carried a mutated p53 gene (Table 1Go; see below).

Twelve tumors (43%) had p53 mutations. Seven (88%) of eight tumors carrying a mutation at the INK4a-ARF locus also had one or more mutations in the p53 gene (Table 1Go). In addition, four XP-associated tumors without a mutated INK4a-ARF locus had p53 mutations (Tables 1 and 2GoGo). A total of 20 p53 mutations were identified in eight (44%) of 18 SCCs and four (40%) of 10 BCCs. The majority of the mutations occurred at known p53 mutation hot spots (36). Twelve p53 mutations from 21 XP-associated tumors had been characterized previously (3,4). Eight new mutations were identified in three BCCs (Table 1Go) and included four tandem mutations, three C : G->T : A transitions at dipyrimidic sites, and an A->T transversion (Table 1Go). Seven (58%) of 12 tumors harboring a mutated p53 also had an INK4a-ARF mutation (Table 1Go).


View this table:
[in this window]
[in a new window]
 
Table 2. Comparison of the mutation frequencies between xeroderma pigmentosum (XP)-associated and sporadic skin carcinomas
 
Mutational analysis of the CDK4 gene exon 2 encompassing residues previously shown to be mutated in familial melanoma (26,27) or to affect p16INK4a binding (28) showed no SSCP variants in all 28 samples.

A comparative analysis between sporadic tumors [our previous data and data from (22,30,31)] and XP-associated tumors (our current results) is presented in Table 2Go. INK4a-ARF mutations in p16INK4a and p14ARF occur statistically significantly more frequently in XP-associated skin tumors than in sporadic skin tumors (P = .018 and P = .005, respectively). Furthermore, in contrast to sporadic skin tumors, mutations in both p16INK4a and p53 and in p14ARF and p53 are associated in skin tumors from XP patients (P = .008 and P<.001, respectively).


    DISCUSSION
 Top
 Notes
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Recently, we reported the presence of INK4a-ARF mutations in sporadic skin carcinomas (22). Because the INK4a-ARF and p53 pathways interact (17) (Fig. 1Go), we performed a comparative mutational analysis of the p16INK4a-CDK4 and p14ARF-p53 pathways in skin carcinomas from patients with XP, a human disease characterized by a defect in DNA repair. We found that XP-associated tumors had a statistically significantly higher frequency of INK4a-ARF mutations in both p16INK4a and p14ARF than sporadic skin carcinomas (P = .018 and P = .005, respectively) (22,30,31). Our results confirm the importance of the INK4a-ARF locus in epithelial skin tumorigenesis.

The high frequency of INK4a-ARF mutations may be a consequence of the hypermutability and high genetic instability of XP cells. Similar increases in the mutational frequencies between XP-associated and sporadic skin cancers have been demonstrated for the p53 and ras genes both in vitro and in vivo (35,37). In addition, although multiple p16INK4a mutations have so far been reported only in primary sporadic melanomas (38,39), we also found that three XP-associated tumors had multiple p16INK4a mutations and two tumors had multiple p14ARF mutations. The high genetic instability caused by the DNA-repair defect permits the accumulation of unrepaired DNA lesions leading, therefore, to multiple mutations during tumor progression. Consistent with this hypothesis, we (3) and other investigators (40) have found multiple p53 mutations in XP-associated skin carcinomas (Table 1Go).

The mutations detected in the XP-associated tumors were characteristic of UV radiation-induced mutations, since they occurred at dipyrimidic sites as tandem mutations (CC : GG->TT : AA) or transitions (C : G->T : A). This particular mutational pattern has been well described for the p53 gene (41). p16INK4a mutations, including tandem mutations, have also been characterized in sporadic SCCs (22) and in melanoma cell lines and tumors (4245). However, the frequency of p16INK4a tandem mutations in XP-associated tumors (54%) is much higher than in both sporadic skin carcinomas (25%) (22,30,31) and melanomas (12%) (32) and is similar to the frequency of p53 tandem mutations in XP-associated tumors (55%). It should be noted that at least 71% of tumors carrying p16INK4a tandem mutations came from XP-C patients (Table 1Go) and that p53 tandem mutations were found previously to be preferentially associated with this XP complementation group (3).

The majority of the p16INK4a mutations occurred at known mutational hot spots (32,33), and three amino acid changes—Arg58Ter (termination), Arg80Ter, and Pro114Leu—accounted for more than two thirds of the total p16INK4a mutations (Table 1Go). Genetic alterations leading to the Pro114Leu change are found predominantly in melanoma cell lines (32). We detected the Pro114Leu change in four of eight XP-associated skin carcinomas in this study (Table 1Go) and in one sporadic skin carcinoma in a previous study (22). The high frequency of the Pro114Leu mutation may be related to the nucleotide composition at positions 340–342: CCC. CCC is a prime target for UV radiation-induced mutagenesis. However, there is also the possibility that Pro114 plays a crucial role in the structure or function of the p16INK4a or p14ARF proteins. Indeed, pro114 is found within an ankyrin domain that is known to be critical for protein–protein interactions.

Of the nine p16INK4a mutants reported previously in sporadic skin carcinomas, seven (78%) also induced a change in the p14ARF reading frame because they occurred in a shared exon (22,31). As a consequence and with the knowledge that p19ARF exon 1{beta} knockout mice develop skin tumors spontaneously (12), inactivation of p14ARF may be relevant in the tumorigenesis of nonmelanoma skin tumors. In our study, all of the XP-associated tumors with p16INK4a mutations had p14ARF mutations. The functional consequence of the p14ARF mutations is unknown, but it may be related to the intracellular location of the protein. Recent data (18) have shown that some p14ARF exon 2 tumor mutants are impaired in both p14ARF nucleolar localization and p53 stabilization. Furthermore, a p14ARF mutant lacking amino acid residues 82–101 also affects p14ARF function (i.e., causes nuclear and cytoplasmic diffusion of the protein) (18). One p14ARF mutant identified in our study, Pro94Leu, was localized at a conserved residue within this p14ARF functional domain and, therefore, might also affect p14ARF localization and function.

Statistical analysis showed a significant positive association in XP-associated tumors between the occurrence of p16INK4a mutations and p53 mutations (P = .008) and also between the occurrence of p53 and p14ARF mutations (P<.001; Table 2Go). These associations are striking because, although mutation of p53 is common in sporadic skin carcinoma (46), simultaneous inactivation of p53 and p16INK4a or of p53 and p14ARF is rare in human tumors (13,47). High genetic instability could be one explanation for the mutation of both p53 and p16INK4a and of p53 and p14ARF seen in XP-associated tumor cells because it could lead to the preferential selection of tumor clones harboring mutations in multiple genes. In fact, recent data suggest the existence of cooperative effects of the p16INK4a-pRb and p14ARF-p53 pathways. p16INK4a mutations destabilize the G1/S checkpoint by inactivating pRb and releasing E2F transcription factors that directly activate p14ARF. Induction of p14ARF then stabilizes p53 and permits p53-mediated apoptosis (48) (Fig. 1Go). p14ARF mutants would be deficient in stabilizing p53 and inhibit p53-mediated apoptosis. Likewise, p53 mutations could confer a selective cellular growth advantage by attenuating apoptosis induced by DNA damage, allowing mutations in other genes (including in p16INK4a) to accumulate and promoting tumorigenesis.

Finally, p14ARF functions do not fully overlap with those of p53 (17), since a loss of p53 occurs in cancers arising in p19ARF null mice, indicating that selection against p53 can further contribute to malignancy (49). Thus, inactivation of both genes can have an additive effect in the tumorigenic process.

In conclusion, we found a higher level of UV radiation-induced mutations of the INK4a-ARF locus in XP-associated skin carcinomas than in sporadic skin tumors. Moreover, the statistically significant association of INK4a-ARF and p53 mutations in XP-associated skin carcinomas suggests a multistep process that is characterized by the loss and/or inactivation of multiple tumor suppressor genes. The cooperation between INK4a-ARF and p53 could account for the accelerated formation of tumors in patients with XP.


    NOTES
 
Supported by grants from the Académie Nationale de Médecine, ARC, AP-HP, CERIES, and GEFLUC. N. Soufir has a predoctoral fellowship from the Ligue Nationale contre le Cancer.

We thank Dr. M. F. Avril (Service de Dermatologie, Institut Gustave Roussy, Villejuif, France) and Professor B. Bouadjar (Service de Dermatologie, Venereologie Chu Bab El Dued, Algeria) and all the clinicians who collaborated with us in collecting tumors from xeroderma pigmentosum patients in North Africa. We also thank S. Queille, N. Bodak, C. Drougard, and G. Giglia (Cancer Research Institute, Villejuif, France) for help in preparing DNA from tumor samples.


    REFERENCES
 Top
 Notes
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 

1 Jung EG. Xeroderma pigmentosum. Int J Dermatol 1986;25:629–33.[Web of Science][Medline]cancerlit;87108127

2 Kraemer KH, Lee MM, Scotto J. Xeroderma pigmentosum. Cutaneous, ocular, and neurologic abnormalities in 830 published cases. Arch Dermatol 1987;123:241–50.[Abstract/Free Full Text]cancerlit;87126922

3 Giglia G, Dumaz N, Drougard C, Avril MF, Daya-Grosjean L, Sarasin A. p53 mutations in skin and internal tumors of xeroderma pigmentosum patients belonging to the complementation group C. Cancer Res 1998;58:4402–9.[Abstract/Free Full Text]cancerlit;98438060

4 Dumaz N, Drougard C, Sarasin A, Daya-Grosjean L. Specific UV-induced mutation spectrum in the p53 gene of skin tumors from DNA-repair-deficient xeroderma pigmentosum patients. Proc Natl Acad Sci U S A 1993;90:10529–33.[Abstract/Free Full Text]cancerlit;94068434

5 Daya-Grosjean L, Robert C, Drougard C, Suarez H, Sarasin A. High mutation frequency in ras genes of skin tumors isolated from DNA repair deficient xeroderma pigmentosum patients. Cancer Res 1993;53:1625–9.[Abstract/Free Full Text]cancerlit;93201554

6 Bodak N, Queille S, Avril MF, Bouadjar B, Drougard C, Sarasin A, et al. High levels of patched gene mutations in basal-cell carcinomas from patients with xeroderma pigmentosum. Proc Natl Acad Sci U S A 1999;96:5117–22.[Abstract/Free Full Text]cancerlit;99238492

7 Loughran O, Edington KG, Berry IJ, Clark LJ, Parkinson EK. Loss of heterozygosity of chromosome 9p21 is associated with the immortal phenotype of neoplastic human head and neck keratinocytes. Cancer Res 1994;54:5045–9.[Abstract/Free Full Text]cancerlit;95007501

8 Munro J, Stott FJ, Vousden KH, Peters G, Parkinson EK. Role of the alternative INK4A proteins in human keratinocyte senescence: evidence for the specific inactivation of p16INK4A upon immortalization. Cancer Res 1999;59:2516–21.[Abstract/Free Full Text]cancerlit;99290632

9 Loughran O, Malliri A, Owens D, Gallimore PH, Stanley MA, Ozanne B, et al. Association of CDKN2A/p16INK4A with human head and neck keratinocyte replicative senescence: relationship of dysfunction to immortality and neoplasia. Oncogene 1996;13:561–8.[Web of Science][Medline]cancerlit;96330336

10 Quinn AG, Sikkink S, Rees JL. Basal cell carcinomas and squamous cell carcinomas of human skin show distinct patterns of chromosome loss. Cancer Res 1994;54:4756–9.[Abstract/Free Full Text]cancerlit;94340609

11 Serrano M, Lee HW, Chin L, Cordon-Cardo C, Beach D, DePinho RA. Role of the INK4a locus in tumor suppression and cell mortality. Cell 1996;85:27–37.[CrossRef][Web of Science][Medline]cancerlit;96180716

12 Kamijo T, Zindy F, Roussel M, Quelle DE, Downing JR, Ashmun RA, et al. Tumor suppression at the INK4a locus mediated by the alternative reading frame product p19ARF. Cell 1997;91:649–59.[CrossRef][Web of Science][Medline]cancerlit;98054007

13 Sharpless NE, DePinho RA. The INK4A/ARF locus and its two gene products. Curr Opin Genet Dev 1999;9:22–30.[CrossRef][Web of Science][Medline]cancerlit;99172032

14 Enders GH, Koh J, Missero C, Rustgi AK, Harlow E. p16 inhibition of transformed and primary squamous epithelial cells. Oncogene 1996;12:1239–45.[Web of Science][Medline]cancerlit;96226355

15 Liggett WH Jr, Sewell DA, Rocco J, Ahrendt SA, Koch W, Sidransky D. p16 and p16 beta are potent growth suppressors of head and neck squamous carcinoma cells in vitro. Cancer Res 1996;56:4119–23.[Abstract/Free Full Text]cancerlit;96390591

16 Serrano M, Hannon GJ, Beach D. A new regulatory motif in cell-cycle control causing specific inhibition of cyclin D/CDK4. Nature 1993;366:704–7.[CrossRef][Medline]cancerlit;94081956

17 Stott FJ, Bates S, James MC, McConnell BB, Starborg M, Brookes S, et al. The alternative product from the human CDKN2A locus, p14(ARF), participates in a regulatory feedback loop with p53 and MDM2. EMBO J 1998;17:5001–14.[CrossRef][Web of Science][Medline]cancerlit;98393541

18 Zhang Y, Xiong Y. Mutations in human ARF exon 2 disrupt its nucleolar localization and impair its ability to block nuclear export of MDM2 and p53. Mol Cell 1999;3:579–91.[CrossRef][Web of Science][Medline]cancerlit;99288446

19 Sherr CJ, Weber JD. The ARF/p53 pathway. Curr Opin Genet Dev 2000;10:94–9.[CrossRef][Web of Science][Medline]cancerlit;20145639

20 Ruas M, Peters G. The p16INK4a/CDKN2A tumor suppressor and its relatives. Biochim Biophys Acta 1998;1378:F115–77.[Medline]cancerlit;99040708

21 Wang XQ, Gabrielli BG, Milligan A, Dickinson JL, Antalis TM, Ellem KA. Accumulation of p16CDKN2A in response to ultraviolet irradiation correlates with late S-G2-phase cell cycle delay. Cancer Res 1996;56:2510–4.[Abstract/Free Full Text]cancerlit;96221146

22 Soufir N, Moles JP, Vilmer C, Moch C, Verola O, Rivet J, et al. P16 UV mutations in skin epithelial tumours. Oncogene 1999;18:5477–81.[CrossRef][Web of Science][Medline]cancerlit;99429955

23 Zeng L, Sarasin A, Mezzina M. Novel complementation assays for DNA repair-deficient cells. Transient and stable expression of DNA repair genes. Methods Mol Biol 1999;113:87–100.[Medline]cancerlit;99372360

24 Masutani C, Kusumoto R, Yamada A, Dohmae N, Yokoi M, Yuasa M, et al. The XPV (xeroderma pigmentosum variant) gene encodes human DNA polymerase eta. Nature 1999;399:700–4.[CrossRef][Medline]cancerlit;99311850

25 Hayashi K. PCR–SSCP: a method for detection of mutations. Genet Anal Tech Appl 1992;9:73–9.[Medline]cancerlit;93119727

26 Soufir N, Avril MF, Chompret A, Demenais F, Bombled J, Spatz A, et al. Prevalence of p16 and CDK4 germline mutations in 48 melanoma-prone families in France. The French Familial Melanoma Study Group. Hum Mol Genet 1998;7:209–16.[Abstract/Free Full Text]cancerlit;98087572

27 Zuo L, Weger J, Yang Q, Goldstein AM, Tucker MA, Walker GJ, et al. Germline mutations in the p16INK4a binding domain of CDK4 in familial melanoma. Nat Genet 1996;12:97–9.[CrossRef][Web of Science][Medline]cancerlit;96122049

28 Coleman KG, Wautlet BS, Morrissey D, Mulheron J, Sedman SA, Brinkley P, et al. Identification of CDK4 sequences involved in cyclin D1 and p16 binding. J Biol Chem 1997;272:18869–74.[Abstract/Free Full Text]cancerlit;97373589

29 Blevins L, McDonald CJ. Fisher's Exact Test: an easy-to-use statistical test for comparing outcomes. MD Comput 1985;2:15–9, 68.[Medline]

30 Kubo Y, Urano Y, Matsumoto K, Ahsan K, Arase S. Mutations of the INK4a locus in squamous cell carcinomas of human skin. Biochem Biophys Res Commun 1997;232:38–41.[CrossRef][Web of Science][Medline]cancerlit;97236276

31 Kubo Y, Urano Y, Fukuhara K, Matsumoto K, Arase S. Lack of mutation in the INK4a locus in basal cell carcinomas [letter]. Br J Dermatol 1998;139:340–1.[CrossRef][Web of Science]cancerlit;99068970

32 Smith-Sorensen B, Hovig E. CDKN2A (p16INK4A) somatic and germline mutations. Hum Mutat 1996;7:294–303.[CrossRef][Web of Science][Medline]cancerlit;96303699

33 Pollock PM, Pearson JV, Hayward NK. Compilation of somatic mutations of the CDKN2 gene in human cancers: non-random distribution of base substitutions. Genes Chromosomes Cancer 1996;15:77–88.[CrossRef][Web of Science][Medline]cancerlit;96431088

34 Yang R, Serrano M, Slater J, Leung E, Koeffler HP. Analysis of p16INK4a and its interaction with CDK4. Biochem Biophys Res Commun 1996;218:254–9.[CrossRef][Web of Science][Medline]

35 Koh J, Enders GH, Dynlacht BD, Harlow E. Tumour-derived p16 alleles encoding proteins defective in cell-cycle inhibition. Nature 1995;375:506–10.[CrossRef][Medline]cancerlit;95295835

36 Beroud C, Soussi T. p53 gene mutation: software and database. Nucleic Acids Res 1998;26:200–4.[Abstract/Free Full Text]cancerlit;98062429

37 Steingrimsdottir H, Beare D, Carr AM, Cole J, Lehmann AR. U.v.-hypermutability of xeroderma pigmentosum cells demonstrated with a DNA-based mutation system. Oncogene 1995;10:2057–66.[Web of Science][Medline]cancerlit;95281232

38 Gruis NA, Weaver-Feldhaus J, Liu Q, Frye C, Eeles R, Orlow I, et al. Genetic evidence in melanoma and bladder cancers that p16 and p53 function in separate pathways of tumor suppression. Am J Pathol 1995;146:1199–206.[Abstract]cancerlit;95266664

39 Kumar R, Lundh Rozell B, Louhelainen J, Hemminki K. Mutations in the CDKN2A (p16INK4a) gene in microdissected sporadic primary melanomas. Int J Cancer 1998;75:193–8.[CrossRef][Web of Science][Medline]cancerlit;98122539

40 Williams C, Ponten F, Ahmadian A, Ren ZP, Ling G, Rollman O, et al. Clones of normal keratinocytes and a variety of simultaneously present epidermal neoplastic lesions contain a multitude of p53 gene mutations in a xeroderma pigmentosum patient. Cancer Res 1998;58:2449–55.[Abstract/Free Full Text]cancerlit;98283407

41 Brash DE, Rudolph JA, Simon JA, Lin A, McKenna GJ, Baden HP, et al. A role for sunlight in skin cancer: UV-induced p53 mutations in squamous cell carcinoma. Proc Natl Acad Sci U S A 1991;88:10124–8.[Abstract/Free Full Text]cancerlit;92052223

42 Kamb A, Gruis NA, Weaver-Feldhaus J, Liu Q, Harshman K, Tavtigian SV, et al. A cell cycle regulator potentially involved in genesis of many tumor types. Science 1994;264:436–40.[Abstract/Free Full Text]cancerlit;94204645

43 Maestro R, Boiocchi M. Sunlight and melanoma: an answer from MTS1 [letter]. Science 1995;267:15–6.[Free Full Text]cancerlit;95108544

44 Healy E, Sikkink S, Rees JL. Infrequent mutation of p16INK4 in sporadic melanoma. J Invest Dermatol 1996;107:318–21.[CrossRef][Web of Science][Medline]cancerlit;96354728

45 Pollock PM, Yu F, Qiu L, Parsons PG, Hayward NK. Evidence for u.v. induction of CDKN2 mutations in melanoma cell lines. Oncogene 1995;11:663–8.[Web of Science][Medline]cancerlit;95380172

46 Basset-Seguin N, Moles JP, Mils V, Dereure O, Guilhou JJ. TP53 tumor suppressor gene and skin carcinogenesis. J Invest Dermatol 1994;103(5 Suppl):102S–106S.[CrossRef][Medline]

47 Pomerantz J, Schreiber-Agus N, Liegeois NJ, Silverman A, Alland L, Chin L, et al. The Ink4a tumor suppressor gene product, p19Arf, interacts with MDM2 and neutralizes MDM2's inhibition of p53. Cell 1998;92:713–23.[CrossRef][Web of Science][Medline]cancerlit;98188097

48 Bates S, Phillips AC, Clark PA, Stott F, Peters G, Ludwig RL, et al. p14ARF links the tumour suppressors RB and p53 [letter]. Nature 1998;395:124–5.[CrossRef][Medline]cancerlit;98415516

49 Sherr CJ. Tumor surveillance via the ARF-p53 pathway. Genes Dev 1998;12:2984–91.[Free Full Text]cancerlit;98438445

50 Hainaut P, Hernandez T, Robinson A, Rodriguez-Tome P, Flores T, Hollstein M, et al. IARC Database of p53 gene mutations in human tumors and cell lines: updated compilation, revised formats and new visualisation tools. Nucleic Acids Res 1998;26:205–13.[Abstract/Free Full Text]cancerlit;98062430

Manuscript received January 31, 2000; revised August 28, 2000; accepted September 6, 2000.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
CarcinogenesisHome page
P. Boukamp
Non-melanoma skin cancer: what drives tumor development and progression?
Carcinogenesis, October 1, 2005; 26(10): 1657 - 1667.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Couve-Privat, M. Le Bret, E. Traiffort, S. Queille, J. Coulombe, B. Bouadjar, M. F. Avril, M. Ruat, A. Sarasin, and L. Daya-Grosjean
Functional Analysis of Novel Sonic Hedgehog Gene Mutations Identified in Basal Cell Carcinomas from Xeroderma Pigmentosum Patients
Cancer Res., May 15, 2004; 64(10): 3559 - 3565.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
E. Natarajan, M. Saeb, C. P. Crum, S. B. Woo, P. H. McKee, and J. G. Rheinwald
Co-Expression of p16INK4A and Laminin 5 {gamma}2 by Microinvasive and Superficial Squamous Cell Carcinomas in Vivo and by Migrating Wound and Senescent Keratinocytes in Culture
Am. J. Pathol., August 1, 2003; 163(2): 477 - 491.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pathol.Home page
A Tannapfel, C Busse, F Geissler, H Witzigmann, J Hauss, and C Wittekind
INK4a-ARF alterations in liver cell adenoma
Mol. Pathol., December 1, 2002; 55(6): 379 - 384.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
A Tannapfel, C Busse, F Geissler, H Witzigmann, J Hauss, and C Wittekind
INK4a-ARF alterations in liver cell adenoma
Gut, August 1, 2002; 51(2): 253 - 258.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J.-L. Luo, W.-M. Tong, J.-H. Yoon, M. Hergenhahn, R. Koomagi, Q. Yang, D. Galendo, G. P. Pfeifer, Z.-Q. Wang, and M. Hollstein
UV-induced DNA Damage and Mutations in Hupki (Human p53 Knock-in) Mice Recapitulate p53 Hotspot Alterations in Sun-exposed Human Skin
Cancer Res., November 1, 2001; 61(22): 8158 - 8163.
[Abstract] [Full Text] [PDF]


Home page
Arch DermatolHome page
H. Tsao
Genetics of Nonmelanoma Skin Cancer
Arch Dermatol, November 1, 2001; 137(11): 1486 - 1492.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
W. Jiang, H. N. Ananthaswamy, H. K. Muller, A. Ouhtit, S. Bolshakov, S. E. Ullrich, A. K. El-Naggar, and M. L. Kripke
UV irradiation augments lymphoid malignancies in mice with one functional copy of wild-type p53
PNAS, July 24, 2001; (2001) 171066498.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. Spatz, G. Giglia-Mari, S. Benhamou, and A. Sarasin
Association between DNA Repair-deficiency and High Level of p53 Mutations in Melanoma of Xeroderma Pigmentosum
Cancer Res., March 1, 2001; 61(6): 2480 - 2486.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
W. Jiang, H. N. Ananthaswamy, H. K. Muller, A. Ouhtit, S. Bolshakov, S. E. Ullrich, A. K. El-Naggar, and M. L. Kripke
UV irradiation augments lymphoid malignancies in mice with one functional copy of wild-type p53
PNAS, August 14, 2001; 98(17): 9790 - 9795.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Request Permissions
Google Scholar
Right arrow Articles by Soufir, N.
Right arrow Articles by Basset-Seguin, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Soufir, N.
Right arrow Articles by Basset-Seguin, N.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?