© 2000 by Oxford University Press
Journal of the National Cancer Institute, Vol. 92, No. 16, 1336-1344,
August 16, 2000
© 2000 Oxford University Press
Real-Time Quantitative Polymerase Chain Reaction Assessment of Immune Reactivity in Melanoma Patients After Tumor Peptide Vaccination
Affiliation of authors: Surgery Branch, Division of Clinical Sciences, National Cancer Institute, Bethesda, MD.
Correspondence to: Francesco M. Marincola, M.D., National Institutes of Health, Bldg. 10, Rm. R-2B56, 10 Center Dr., Bethesda, MD 20892-1184 (e-mail: marincola{at}nih.gov).
| ABSTRACT |
|---|
|
|
|---|
Background: Monitoring the immune response to epitope-specific vaccination in cancer patients is important for vaccine development. The traditional method, in which the in vitro sensitization of peripheral blood mononuclear cells (PBMCs) with epitope is compared before and after vaccination, is time-consuming and allows only a qualitative assessment of the response. We used a rapid, quantitative, real-time polymerase chain reaction (PCR) assay to directly measure the immune reactivity of patients' PBMCs to the vaccine epitope. Methods: PBMCs were obtained from melanoma patients before and after two rounds of vaccination with either g209-2M, a peptide derived from melanoma protein gp100 (n = 24), or ESg209-2M, a modified version of this peptide (n = 20). PBMCs were tested for immune reactivity by assaying interferon gamma (IFN
) protein release after in vitro sensitization with the epitope or for IFN
messenger RNA expression by real-time PCR. A twofold or more increase in IFN
protein release or a 1.5-fold or more increase in IFN
transcript accumulation in PBMCs after vaccination was considered to be evidence of a specific response. Correlation between the two methods was tested by use of the Spearman correlation coefficient after the results were ranked as positive or negative. All statistical tests were two-sided. Results: The results obtained with the two methods were strongly correlated (Spearman's rho = 0.72; P = .0006). The g209-2M and Esg209-2M peptides resulted in similar percentages of vaccine-specific reactivity in PBMCs after in vitro sensitization (63% and 65% of patients, respectively; Fisher's exact test P = .6 for comparison of the two groups). The PCR method could detect vaccine-specific reactivity in a subset of patients (38% and 35% of patients, respectively; Fisher's exact test P = .7 for comparison of the two groups). Conclusion: Vaccination induces circulating antitumor lymphocytes, albeit in low frequencies, capable of directly reacting with tumor antigen. PBMCs of vaccinated individuals can respond to a vaccine-specific stimulus in a direct assay that does not require prolonged in vitro manipulations.
| INTRODUCTION |
|---|
|
|
|---|
The development of sensitive methods for the detection of immune response against tumor antigens is essential for a rational approach to the development of cancer vaccines in humans. In pilot clinical trials, immunization with peptides derived from tumor antigens has been shown to mediate an increase in peripheral blood of circulating precursors that have antipeptide and antitumor activities (15). The assays capable of detecting these reactivities depend on the in vitro sensitization (2,3,68). This in vitro sensitization assay involves incubation of peripheral blood mononuclear cells (PBMCs) with the peptide used for in vivo immunization and subsequent testing of the cultured PBMCs for either cytokine release or lysis of antigen-expressing target cells.
The low frequency of vaccine-elicited precursors has precluded the ability to detect these reactivities in lymphocytes obtained directly from peripheral blood, and the in vitro amplification of these precursor cells by incubation with antigen has been necessary to enable their detection. Thus, analysis of the anergic or tolerant state of circulating PBMCs to tumor antigens is difficult because of the reversible nature of the functional state of the lymphocytes following this prolonged in vitro incubation with the antigens. Approaches to directly measure the antitumor immune status of individuals by use of lymphocyte preparations obtained directly from peripheral blood, without in vitro incubation with antigen, have included the use of the human leukocyte antigen (HLA)/peptide tetrameric complexes (9). However, this technique has generally been difficult to apply to the detection of tumor-specific lymphocytes because of their low precursor frequency and the sensitivity limitations of fluorescence-activated cell-sorting analysis (10). Furthermore, tetramers are capable of measuring the presence of receptor but not the functional state or the ability of lymphocytes to respond by activation in response to exposure to tumor antigen. Other approaches to estimate the frequency of precursors of cytotoxic T lymphocytes (CTLs), including enzyme-linked immunospot (ELISPOT) (11,12) and limiting dilution (13), have not proved to be sensitive for the efficient analysis of samples from patients undergoing clinical trials for cancer vaccines.
We (5) have reported previously our experience treating patients with metastatic melanoma with a synthetically modified melanoma peptide derived from the gp100 protein gp100:209-217(210M) that was emulsified in incomplete Freund's adjuvant (IFA). This peptide has a methionine substituted for a tyrosine in position 210 of the sequence of the wild-type epitope and will be abbreviated g209-2M in this article, while the wild-type epitope (gp100 : 209-217) will be abbreviated g209. In vitro sensitization and assays involving expansion of PBMCs demonstrated that in vivo administration of the modified peptide was superior to that of the parental g209 in inducing in vitro CTL reactivity against the 209-217 epitope and HLA-A2-positive melanoma cells.
In this study, we have used a sensitive, quantitative, real-time polymerase chain reaction (PCR) assay to directly assess the immune status of PBMCs from patients prior to any in vitro stimulation with antigen. Real-time PCR includes the addition of an hybridization step with each PCR cycle, whereby a probe annealing to the amplified material is cleaved by the polymerase reaction and becomes fluorescent in this process (14,15). Defining the number of PCR cycles necessary to achieve a certain threshold of fluorescence in a test sample compared with standard samples allows accurate estimation of transcript abundance in a given specimen.
The purpose of this study was to optimize this assay and to use it to compare immune response following vaccination with the g209-2M peptide or with a modified form of this peptide, ESg209-2M, which is a fusion peptide with an endoplasmic reticulum signal sequence (ES). Most importantly, we wanted to test whether lymphocytes obtained directly from the peripheral blood of patients vaccinated with these peptides can respond within 12 hours of exposure to the tumor peptide by production of messenger RNA (mRNA) encoding interferon gamma (IFN
). The demonstration of production of this cytokine in response to epitope-specific stimulation of circulating cells may be able to definitively identify the anergy of vaccine-elicited T cells exposed to minimal ex vivo manipulation. This issue has important implications in understanding the tumorhost interactions.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Peptides
Each of the peptides used in this study was prepared under Good Manufacturing Practice (GMP) conditions by Multiple Peptide Systems (San Diego, CA). The following peptides were used for immunization as described later: the peptides representing the natural epitopes gp100 : amino acids 209217 (g209) (ITQVPFSV), gp100 : amino acids 154162 (g154) (KTWGQYWQV), and MART-1 : amino acids 2735 (AAGIGILTV) as well as the single amino acid-substituted peptides gp100 : amino acids 209217 (210M) (IMQVPFSV), ESg209-217 (210M) (RYMILGLLALAAVCSAMIMQVPFSV), gp100 : amino acids 280288 (288V) (YLEPGPVTV), and tyrosinase 369377 (371D) (YMDGTMSQV). The following abbreviations will be used for the modified peptide, with the digit (after the hyphen) appearing immediately before the letter identifying the position of the change in the modified peptide and the letter identifying the new substituted amino acid: g209-2M, ES-G209-2M, g280-9V, and tyrosinase 369-2D. The identity of each of the peptides was confirmed by mass spectral analysis. For in vitro sensitization and real-time PCR studies, the reactivities toward g209, g209-2M, and control peptide g154 (irrelevant to the vaccination) were tested.
Cultured Cell Lines
The melanoma cell lines 624.38 Mel (HLA-A2+), 624.28 Mel (HLA-A2-), 888 (A2) Mel (HLA-A2+), 888 Mel (HLA-A2-), 526 Mel (HLA-A2+), and 938 Mel (HLA-A2-) were established in the Surgery Branch, National Cancer Institute, Bethesda, MD, and were maintained in continuous culture in RPMI-1640 medium (Biofluids, Rockville, MD) supplemented with 10 mM HEPES buffer, 100 U/mL penicillinstreptomycin (Biofluids), 10 µg/mL Ciprofloxacin (Bayer, West Haven, CT), 0.03% L-glutamine (Biofluids), 0.5 mg/mL amphotericin B (Biofluids), and 10% heat-inactivated fetal bovine serum (Biofluids). All melanoma-derived cell lines were positive for melanoma-specific antigen g100.
Clinical Protocols
All patients had histologically confirmed metastatic melanoma and underwent a complete clinical evaluation, including measurements and radiographic imaging of all assessable tumor sites. Two sequential clinical trials were performed. Both protocols were approved by the Clinical Research Committee of the National Cancer Institute. Patients signed a written informed consent before enrollment in the protocols. All patients were verified not to have had any treatment in the prior month or to have received any immunosuppressive drugs, including steroids. Before treatment, patients underwent a leukapheresis. PBMCs were isolated by FicollHypaque separation, cryopreserved at 108 cells per vial, and stored at -180 °C. HLA typing and subtyping for HLA class I for patients' PBMCs were performed by use of sequence-specific primers in the PCR assay (16).
In the first trial, 35 patients were simultaneously administered four peptides, including g209-2M, g280-9V, MART-1 27-35, and tyrosinase 369-2D. For each peptide, 1.5 mg in 1.5 mL was mixed with an equal volume of IFA (Montanide ISA-51, Seppic, France) and vortexed vigorously to form an emulsion. Each peptide was injected separately as two aliquots of 1 mL containing a total of 1 mg of peptide into the subcutaneous tissue of four separate limbs of the patient. Peptide injections were administered as a rotation of different limbs for subsequent cycles. Patients were vaccinated in the outpatient clinic every 3 weeks and underwent leukapheresis every other immunization round. Leukaphereses were performed 3 weeks after the last immunization and just before the next. In this trial, 16 patients received two cycles of treatment with peptide alone, and 19 patients received two cycles of peptides alone before beginning the planned treatment with peptide plus high-dose interleukin 2 (IL-2). Thus, all 35 patients considered in this article received at least two cycles of peptides alone in IFA, and all analyses were conducted on samples obtained prior to and 3 weeks after these two cycles and before any IL-2 was administered.
In the second trial, 22 patients received the ESg209-2M peptide administered in IFA at the same dose as described above. Injections were given in two divided aliquots into the subcutaneous tissue of the anterior thigh. All 22 of these patients received peptides in IFA for two cycles. Thirteen of the patients then went on to receive additional cycles of peptide plus IL-2 administered either intravenously or subcutaneously. All analyses described in this article were conducted on samples obtained prior to and after the two cycles of immunization with peptide in IFA only and before the administration of IL-2. The characteristics of the two treatment groups were similar. Seventeen (39%) of 44 patients (in both trials) were between the ages of 31 and 70 years. All patients had a good performance status (Eastern Cooperative Oncology Group [ECOG] score 0 or 1). All patients had undergone previous surgery, and 16 (36%) had received previous systemic chemotherapy and/or immunotherapy.
Evaluation of Response to Treatment
All known sites of metastatic disease were evaluated after two cycles of vaccination with physical examination and radiologic imaging. A complete response was defined as the complete disappearance of all assessable disease. A partial response was defined as a decrease of 50% or more in the sum of the products of the greatest perpendicular dimensions of all assessable lesions, with no increase in the size of any lesions or appearance of new lesions. Disease progression was defined as an overall increase of at least 25% in the sum of the products of the greatest perpendicular dimensions of all assessable lesions.
In Vitro Sensitization Assay of Peptide and Melanoma-Specific CTL Reactivity
As described previously (2,5), cryopreserved PBMCs were thawed in complete medium consisting of Iscove's modified Dulbecco's modified Eagle medium (Biofluids) supplemented with 10 mM HEPES buffer, 100 U/mL penicillinstreptomycin (Biofluids), 10 µg/mL Ciprofloxacin (Bayer), 0.03% L-glutamine (Biofluids), 0.5 mg/mL amphotericin B (Biofluids), and 10% heat-inactivated human AB serum (Gemini Bioproducts Inc., Calabasas, CA). Cells were plated at 3 x 106 PBMCs in 2 mL of medium with 1 µM peptide (g209 or g154). IL-2 (300 IU/mL) was added on day 2, and the cells were harvested between day 10 and day 13 after initiation of the culture. The harvested cells were then stimulated with melanoma cells or the antigen-processing-defective, HLA-A*0201-expressing T2 cells (17) pulsed with 1 µM g209 peptide or a control peptide g154 for 1824 hours at 37 °C. The release of IFN
into the supernatant was measured by enzyme-linked immunosorbent assay (ELISA). The reactivity was scored as positive (+) if IFN
release was twice the background level (i.e., reactivity to g154 peptide) and greater than 100 pg/mL supernatant, as described previously (5).
RNA Isolation and Complementary DNA Synthesis
RNA isolation from PBMCs was performed in batches containing patients' pretherapy and post-therapy samples with RNeasy minikits (Qiagen, Santa Clarita, CA). The RNA was eluted with water and stored at -70 °C. For complementary DNA (cDNA) synthesis, about 1 µg of total RNA was transcribed with cDNA Transcription Reagents (The Perkin-Elmer Corp., Foster City, CA) with the use of random hexamers. cDNA was stored at -30 °C until quantitative real-time PCR was performed.
Quantitative Real-Time PCR
Gene expression was measured with the use of the ABI Prism 7700 Sequence Detection System (The Perkin-Elmer Corp.) as described previously (14,15). We (18) have previously validated the feasibility of this approach for the analysis of antigen-specific T-cell responses both in peripheral blood lymphocytes and in tumor tissues. Primers and TaqMan probes (Custom Oligonucleotide Factory, Foster City, CA) were designed to span exonintron junctions to prevent amplification of genomic DNA and also to result in amplicons of fewer than 150 base pairs to enhance efficiency of PCR amplification. Probes were labeled at the 5` end with the reporter dye molecule FAM (6-carboxy-fluorescein; emission
max = 518 nm) and at the 3` end with the quencher dye molecule TAMARA (6-carboxytetramethyl-rhodamine; emission
max = 582 nm). Upon amplification, probes annealed to the template are cleaved by the 5`-nuclease activity of Taq polymerase reaction. This process separates the fluorescent label from the quencher and allows release of 1 U of fluorescence for each unit amplification. By the determination of the amount of fluorescence with each cycle, it is possible to determine the number of cycles necessary to reach a certain amount of fluorescence in a test sample compared with known standard amounts of template provided as a standard curve. DNA standards were generated by PCR amplification of gene products, purification, and quantitation by spectrophotometry (absorbance at 260 nm). The number of copies was calculated with the use of the molecular weight of each gene amplicon. Real-time PCRs of cDNA specimens and DNA standards were conducted in a total volume of 25 µL with 1x TaqMan Master Mix (The Perkin-Elmer Corp.) and primers at 400600 nM and probes at 160 nM. Primer sequences were as follows: IFN
(forward) (5`)-AGCTCTGCATCGTTTTGGGTT; IFN
(reverse) (5`)-GTTCCATTATCCGCTACATCTGAA; IFN
(probe) FAM-TCTTGGCTGTTACTGCCAGGACCCA-TAMRA; CD8 (forward) (5`)- CCCTGAGCAACTCCATCATGT; CD8 (reverse) (5`)- GTGGGCTTCGCTGGCA; and CD8 (probe) FAM-TCAGCCACTTCGTGCCGGTCTTC-TAMRA. Thermal cycler parameters included 2 minutes at 50 °C, 10 minutes at 95 °C, and 40 cycles involving denaturation at 95 °C for 15 seconds and annealing/extension at 60 °C for 1 minute. Standard curves were generated for both IFN
and CD8. PCR efficiency was assessed from the slopes of the standard curves and was found to be between 90% and 100%. Linear regression analysis of all standard curves demonstrated a coefficient of determination (R2) of 0.99 or higher. Standard curve extrapolation of copy number was performed for both IFN
and CD8. Normalization of sample data was done by dividing the number of copies of IFN
transcripts by the number of copies of CD8 transcripts.
Direct PCR Assay of Peptide and Melanoma-Specific CTL Reactivity
Cryopreserved PBMCs were thawed in complete medium. On the basis of optimization experiments (described in the "Results" section), direct assays on PBMCs were conducted with the use of 5 x 106 PBMCs in 1.5 mL of medium, which were allowed to physiologically recover by incubation at 37 °C in 5% CO2 for 10 hours. Either 1 µM of the wild-type g209 peptide, a control peptide (vaccine irrelevant) g154, or 1 x 106 melanoma cells were then added to the PBMCs and incubated at 37 °C in 5% CO2 for 2 hours. No exogenous cytokines or other stimulants were added. The cells were then harvested for RNA isolation and cDNA transcription. Quantitative real-time PCR was performed for IFN
mRNA expression and normalized to copies of CD8 mRNA from the same sample. PBMCs from the 44 patients presented in this study were tested only once by quantitative real-time PCR because of limitation in the amount of PBMC material available. We (18) have shown previously, however, that results obtained with this direct method are highly reproducible.
Measurement of mRNA Levels of Other Cytokines
In preliminary analysis, we also made measurements of gene expression for the CD69, a marker of CTL activation, the IL-2
receptor (CD25), and the cytokines tumor necrosis factor-
, granulocytemonocyte colony-stimulating factor (GM-CSF), and IL-2 by previously described methods (18).
Statistical Analysis
Evidence of specific response to stimulation, as determined by quantitative real-time PCR studies, consisted of detection of mRNA for IFN
in PBMCs stimulated with relevant (vaccine) peptide/epitope versus irrelevant (unrelated to vaccination) peptide/epitope. IFN
mRNA copy number was first corrected for CD8 mRNA copy number. Data were adjusted for CD8 mRNA copies on the basic immunologic assumption that stimulation with an HLA class I-restricted epitope defines CD8+ T cells as the only relevant population. Since the frequency of CD8+ T cells varies in time in individual patients, we believe that it is incorrect to present data corrected by expression of housekeeping genes, like glyceraldehyde-3-phosphate dehydrogenase (GAPDH) or ß-actin, expressed by any cell as has been done in other quantitative real-time PCR applications (14,15). A cutoff value of 1.5 for the ratio of IFN
mRNA (corrected for CD8 mRNA) obtained from PBMCs stimulated with relevant epitope to that obtained from PBMCs stimulated with irrelevant epitope was considered to be evidence of vaccine-related specificity. The cutoff value was derived by analyzing the IFN
/CD8 ratios in PBMCs obtained from all patients before vaccination who were considered to be not previously exposed to g209 related-epitope exposure. Analysis of these PBMCs identified a mean ratio of 0.96 (range, 0.61.4) with 95% and 99% confidence intervals of 0.96 ± 0.06 and 0.96 ± 0.09, respectively, a standard error of 0.03, and a standard deviation of 0.21. The cutoff ratio (stimulation index) was estimated by adding the upper bound of the confidence limit to the mean and two standard deviations [(0.96 + 0.09) + 2 x 0.21]. The sum resulted in 1.47. This number was then rounded to 1.5. The results of in vitro stimulation were considered to be positive for IFN
protein release when IFN
values (pg/mL) in supernatant of CTL cultures stimulated with relevant peptide were twice the background level (IFN
concentration in CTL cultures stimulated with g154) and greater than 100 pg/mL as reported previously (2,5).
The results obtained with in vitro stimulation were correlated with those obtained with quantitative real-time PCR with the use of the Spearman rank correlation coefficient after results in either assay were ranked as positive (= 1) or negative (= 0). Fisher's exact test was used to test for differences in results between two treatment groups with the use of either in vitro stimulation or quantitative real-time PCR.
| RESULTS |
|---|
|
|
|---|
Development of a Quantitative PCR Assay for Direct Assessment of Peripheral Blood Lymphocyte Reactivity
Measurement of gene expression was done with the use of the ABI Prism 7700 Sequence Detection System (14,15). This system allows real-time PCR monitoring of fluorescent emission from the cleavage of sequence-specific probes by the 5`-nuclease activity of Taq polymerase. At any given cycle within the exponential phase of amplification, defined as the cycle threshold (CT), the amount of PCR product is proportional to the number of initial template copies. Using 10-fold dilutions of IFN
DNA standards of known copy number, we illustrate in Fig. 1
, a, the typical kinetics of PCR amplification with its defined CT. As shown in Fig. 1
, b, the IFN
and CD8 standard curves (plotted as copies of DNA standards versus CT) were found to have an excellent PCR amplification efficiency (90%100%; 100% means that, in each cycle, the amount of template is doubled) as determined by the slope of the standard curves. For the measurement of IFN
mRNA expression for "unknown" samples, IFN
mRNA and CD8 mRNA amplifications were performed synchronously on each sample. CT values were obtained for each gene, and the mRNA copy number for both genes was determined by extrapolation from standard curves. The variability in the number of CD8+ cells in samples and the variability in reverse transcriptase efficiency during cDNA preparation were normalized by dividing the IFN
mRNA copy number by the CD8 mRNA copy number. The CD8 mRNA expression was stable during experiments when compared with the traditional housekeeping genes, such as ß-actin, GAPDH, and ribosomal RNA (data not shown).
|
To develop an assay that directly detects specific antigen recognition and reactivity by CTLs in peripheral blood, we obtained PBMCs from a patient before and after two rounds of g209-2M vaccination. Initial optimization experiments were conducted by simply exposing bulk PBMCs ex vivo to the native g209 peptide. Prior in vitro sensitization or culturing of lymphocytes was not performed, and exogenous cytokines were not added to the cells. The expression of the cytokine gene was quantitated by the measurement of the mRNA, which was isolated from specimens harvested at times ranging from 2 to 10 hours after peptide exposure. As shown in Fig. 1
mRNA (after normalization to CD8 mRNA) after g209 peptide exposure. However, postimmunization PBMCs showed a marked increase in IFN
mRNA, with peak expression between 2 and 3 hours after peptide exposure. In addition, we noted that the g209 peptide induced gene expression for the CD69 representing a marker of CTL activation, the IL-2
receptor (CD25), and the cytokines tumor necrosis factor-
, GM-CSF, and IL-2 (18). Control peptides resulted in no change in cytokine mRNA expression in either the preimmunized or postimmunized samples (data not shown). Since the quantitative expression of IFN
mRNA was several-fold higher than other commonly studied cytokines (Fig. 1Comparison of Immunologic Assays in Patients Immunized With g209-2M
The direct PCR assay for measuring induction of IFN
mRNA was performed on fresh PBMCs from patients who were immunized with the g209-2M peptide. Samples from the same PBMCs also underwent an in vitro sensitization and expansion for approximately 1013 days in the presence of the g209-2M peptide and exogenous IL-2 (in vitro sensitization assay). These cultures were tested for specific reactivity by incubation with target cells (T2) pulsed with the parental g209 peptide or a control peptide g154 and measurement of IFN
cytokine release by ELISA. Table 1
presents a typical experiment using PBMCs from a patient who consistently demonstrated responsiveness after two immunizations. Both the 2-hour direct PCR assay and the 10-day in vitro sensitization assay demonstrated the development of specific reactivity against the natural g209 peptide as well as reactivity against two HLA-A2-positive/gp100-positive melanoma cells but not against two HLA-A2-negative/gp100-positive melanoma cells. Data from two additional patients vaccinated with the g209-2M peptide are shown in Table 2
. Patient 2 exhibited no detectable g209 reactivity directly by the PCR assay; however, after in vitro sensitization and expansion for 10 days, reactivity in the cultures could be detected by both the ELISA and PCR assay. Patient 3 demonstrated neither fresh PBMC reactivity by direct PCR nor culture reactivity as measured by ELISA after in vitro sensitization for 10 days. Furthermore, there was no detectable peptide reactivity when we applied the PCR assay to these expanded cultures. We concluded from these pilot experiments that some patients receiving the g209-2M peptide vaccine could develop a substantial increase in circulating tumor-specific CTLs that could be directly measured without prior in vitro manipulation. However, other patients receiving the identical peptide vaccination showed no evidence of immunization or a low degree of immunization that required in vitro amplification to be detectable.
|
|
Monitoring of Immunization With the g209-2M Peptide in IFA
Table 3
compares the reactivity of PBMCs from 24 of the 35 patients immunized with the g209-2M peptide measured directly with the PCR assay or with the in vitro sensitization assay after 1013 days of culturing. Excluded from this analysis were five patients who were not able to receive at least two vaccinations and six patients from whom sufficient lymphocytes were not available to conduct both assays. In these experiments, evidence of successful g209 immunization was defined as follows: g209 peptide reactivity in PBMCs obtained after immunization was at least two or more times greater than that of the background reactivity to control peptide in the in vitro sensitization assay and 1.5-fold or greater than the background in the direct PCR assay (see "Statistical Analysis" section). Reactivity measured by the in vitro sensitization assay was qualitatively scored as positive (+) or negative (-) to represent the results of multiple experiments. Neither assay detected reactivity against the g209 peptide in patients prior to vaccination. After vaccination, 15 (63%) of 24 patients demonstrated evidence of immunization by the in vitro sensitization assay, while the PCR assay found immune reactivity in fresh lymphocytes in nine (38%) of 24 patients (Fig. 2
). All of these patients were also positive by in vitro sensitization. Direct reactivity was variable from patient to patient, with anti-g209 reactivity ranging from 1.5-fold to 59-fold over background levels. Six patients had reactivity detectable after in vitro culture of their cells, which was not detectable in fresh PBMCs by quantitative real-time PCR. Nine patients showed no evidence of immunization by either assay. Results obtained with the two methods were strongly correlated (Spearman's rho = 0.72; P = .0006).
|
|
Monitoring of Immunization With the ESg209-2M Peptide in IFA
PBMCs from 20 of the 22 patients vaccinated with the ESg209-2M peptide in IFA were analyzed for reactivity as shown in Table 4
. (PBMCs could not be obtained from two patients.) One patient (patient 5) demonstrated prevaccination reactivity against the g209 peptide by the in vitro sensitization assay but not by direct PCR. After vaccination, 13 (65%) of 20 patients had evidence of immunization by the in vitro sensitization assay. Seven (35%) of 20 patients, all of whom were reactive in the in vitro sensitization assay, had detectable reactivity in their fresh blood, with the magnitude of this response ranging from 1.5-fold to 2.3-fold over control levels. Only two patients showed direct reactivity that was at least twice the background level. All patients demonstrating detectable reactivity in their fresh PBMCs also demonstrated reactivity in their PBMCs after 1013 days of culturing in vitro. Seven patients showed no reproducible evidence of immunization by either assay. Also, in this case, there was a good correlation between results obtained with the two methods (Spearman's rho = 0.69; P = .003).
|
Comparison of Immunologic Reactivities After Administration of the g209-2M and ES-g209-2M Peptides
There was no statistically significant difference in the number of patients developing immune reactivity after vaccination with either g209-2M or ES-209-2M as measured by direct PCR analysis of fresh lymphocytes (38% versus 35%, respectively; two-sided Fisher's exact test, P = .7). Similarly, no differences were noted in in vitro sensitized PBMC cultures (63% versus 65%, respectively; two-sided Fisher's exact test, P = .6). Of note, one patient receiving the ESg209-2M peptide demonstrated preimmunization reactivity as well as postimmunization reactivity by the in vitro sensitization assay. Given that the direct PCR measurements were obtained from PBMCs that were not subjected to in vitro manipulation or the associated variability of culturing and expansion, we used this method of quantitation to assess the magnitude of the in vivo immune reactivity after immunization. Five of the nine patients who demonstrated reactivity according to quantitative real-time PCR among the 24 receiving the g209-2M peptide had ratios that were at least twice the background levels. Among the 20 patients who belonged to the ESg209-2M group, only two of the seven patients demonstrating reactivity by quantitative real-time PCR had reactivity levels that were twice the background levels. However, the intensity of the reactivity did not appear to be statistically different between the two groups (two-sided Fisher's exact test, P = .36).
Clinical Response in Patients Receiving the Peptide Vaccines
Immunologic analyses reported here were performed on PBMCs obtained 3 weeks after the second peptide dose. At that time, many patients began treatment with IL-2; thus, clinical data could reflect IL-2 effects and will be reported elsewhere. However, 16 patients received vaccination with the g209-2M peptide and never received IL-2. Two of these patients exhibited a clinical response. One patient had regression of multiple subcutaneous lesions, and the other had regression of visceral metastases involving liver and lung. There were no clinical responses in the nine patients who received the ESg209-2M peptide in IFA alone.
| DISCUSSION |
|---|
|
|
|---|
The development of cancer vaccines has been stimulated over the past decade by the identification of cancer-specific antigens recognized by lymphocytes (1,1922). Although objective tumor regression remains the ultimate goal of any novel immunotherapy, determining clinical benefit from cancer vaccines may be difficult, especially in patients with advanced disease and with limited treatment time windows. Furthermore, it has been proposed that immunization against cancers may have its greatest benefit in an adjuvant or preventive setting. Thus, it has become increasingly important to develop techniques to accurately monitor the immunologic effects of experimental vaccines to facilitate their administration and to gain insight into biologic mechanisms that may guide future therapies. However, the difficulty in functionally assessing the immunologic effectiveness of these agents has been based on the lack of sensitive assays to monitor in vivo cellular immune responses. In previous studies involving the immunization of cancer patients (2,3,68), monitoring of immune reactivity has involved in vitro stimulation of PBMCs to generate cultures with detectable reactivity. Because many of these assays also required repeated administration of exogenous antigens and cytokines, the possibility exists of alteration of the functional characteristics of the originally obtained lymphocytes. Soluble tetramer staining has been used to directly measure epitope-specific CTL precursor frequency in PBMCs in response to viral infections (23,24), but it has shown limited sensitivity for the detection of tumor-specific circulating lymphocytes. Furthermore, unless one combines this assay with staining of intracellular cytokines, the functional reactivity is not necessarily addressed (10).
In this study, we describe the application of a sensitive functional assay to directly measure lymphocyte antitumor reactivity from fresh cells obtained from the peripheral blood of immunized patients. Antitumor and antipeptide CTL reactivities were demonstrated in the majority of PBMCs from patients vaccinated with modified melanoma peptides, as indicated by the production of IFN
mRNA within 2 hours after exposure of fresh PBMCs to the native peptide.
We used this direct PCR assay to monitor and compare the immunization of patients with metastatic melanoma undergoing recent clinical trials with the g209-2M peptide and the further modified ESg209-2M peptide, which represented a fusion peptide with a signal sequence derived from the E3/19 protein of adenovirus type 2. Preclinical animal studies (25) suggested that the addition of this endoplasmic reticulum targeting signal sequences at the amino-terminus of peptides could enhance peptide immunogenicity. We further compared the results obtained with fresh lymphocyte reactivity after vaccination with those obtained by traditional in vitro sensitization and expansion assays.
With the use of the intravenous sensitization assay, the g209-2M peptide and the ESg209-2M peptide resulted in similar percentages of patient immunization (63% versus 65%, respectively). Fresh lymphocyte reactivity, with the use of the direct PCR assay, was found in a subset of these patients but also demonstrated no statistically significant difference between the two-peptide therapies (38% for g209-2M vaccination versus 35% for the ESg209-2M vaccination). We concluded from these experiments that adding the ES signal sequence did not enhance the immunogenicity of the g209-2M peptide in patients with melanoma. Both therapies resulted in tumor-specific CTLs that could be detected in fresh blood and in expanded PBMC cultures. In addition, we saw convincing evidence of tumor regression in two patients receiving outpatient peptide therapy alone.
In comparing the detection of immune reactivity by the two assays, we observed that fresh lymphocyte reactivity was always associated with positive detection of reactivity in the expanded cultures. Likewise, patients' PBMCs that showed no reactivity after in vitro expansion never showed detectable fresh reactivity. However, in both peptide treatment groups, we noted a subset of patients who exhibited no detectable direct lymphocyte reactivity unless their PBMCs underwent sensitization and amplification. In the g209-2M-vaccinated cohort, there were six (40%) of 15 patients who required culturing of their cells in vitro to detect reactivity and six (46%) of 13 patients in the ESg209-2M group who required culturing of their cells in vitro to detect reactivity. These findings most likely represent the limitation of sensitivity of the direct assay. It is interesting that, in this population, we also observed greater variability in the percentage of positive in vitro sensitization experiments when multiple assays were conducted. This finding also suggests that these patients may have had low levels of precursors.
We (18) have recently conducted experiments using this real-time quantitative PCR system to examine serial gene expression in sequential tumor biopsy specimens from patients immunized with both the g209-2M and the ESg209-2M peptides. Our findings demonstrated treatment-related increases in IFN
in lesions after peptide therapy but not in two control groups. More importantly, we were able to detect these changes in the target tumor microenvironment, when peripheral blood demonstrated no reactivity. If tumor biopsy specimens can be obtained easily, we speculate that the analysis of the local tumor microenvironment may represent an additional relevant and sensitive source to monitor immune reactivity.
The direct monitoring of fresh lymphocyte reactivity in PBMCs has several potential benefits. Foremost, it can accurately portray the presence and magnitude of in vivo reactivity to an immunogen. Measurement is not influenced by the inherent variability involved in the culturing of lymphocytes. We have noted substantial variability in lymphocyte expansion and reactivity with different sera used in medium preparation, the presence of fastidious pathogens (such as Mycoplasma), and technical differences among various individuals who grow the cells. We found direct measurement with this PCR assay to be easy and rapid, such that reactivity could be assessed within hours of obtaining cellular material from the patients. Furthermore, this assay can potentially save weeks of time and expense necessary for the expansion of PBMC cultures. The expeditious monitoring of immunologic changes in response to cancer vaccines would be of benefit for patient care and further therapy development. The disadvantage noted in our study was the lower sensitivity of the detection of low precursor reactivity compared with assays that rely on in vitro amplification of the response. We envision our future monitoring of patients to involve a combination of direct monitoring of PBMCs, in vitro expansion of peripheral lymphocytes, and analysis of reactivity at the tumor site.
| REFERENCES |
|---|
|
|
|---|
1
Rosenberg SA. Development of cancer immunotherapies based on identification of the genes encoding cancer regression antigens. J Natl Cancer Inst 1996;88:163544.
2 Cormier JN, Salgaller ML, Prevette T, Barracchini KC, Rivoltini L, Restifo NP, et al. Enhancement of cellular immunity in melanoma patients immunized with a peptide from MART-1/Melan A. Cancer J Sci Am 1997;3:3744.[Web of Science][Medline]cancerlit;97205640
3
Salgaller ML, Marincola FM, Cormier JN, Rosenberg SA. Immunization against epitopes in the human melanoma antigen gp 100 following patient immunization with synthetic peptides. Cancer Res 1996;56:474957.
4
Hu X, Chakraborty NG, Sporn JR, Kurtzman SH, Ergin MT, Mukherji B. Enhancement of cytolytic T lymphocyte precursor frequency in melanoma patients following immunization with the MAGE-1 peptide loaded antigen presenting cell-based vaccine. Cancer Res 1996;56:247983.
5 Rosenberg SA, Yang JC, Schwartzentruber D, Hwu P, Marincola FM, Topalian SL, et al. Immunologic and therapeutic evaluation of a synthetic peptide vaccine for the treatment of patients with metastatic melanoma. Nat Med 1998;4:3217.[CrossRef][Web of Science][Medline]cancerlit;98160242
6 Rivoltini L, Kawakami Y, Sakaguchi K, Southwood S, Sette A, Robbins PF, et al. Induction of tumor-reactive CTL from peripheral blood and tumor-infiltrating lymphocytes of melanoma patients by in vitro stimulation with an immunodominant peptide of the human melanoma antigen MART-1. J Immunol 1995;154:225765.[Abstract]cancerlit;95173432
7
Salgaller ML, Afshar A, Marincola FM, Rivoltini L, Kawakami Y, Rosenberg SA. Recognition of multiple epitopes in the human melanoma antigen gp 100 by peripheral blood lymphocytes stimulated in vitro with synthetic peptides. Cancer Res 1995;55:49729.
8 Marincola FM, Rivoltini L, Salgaller ML, Player M, Rosenberg SA. Differential anti-MART-1/MelanA CTL activity in peripheral blood of HLA-A2 melanoma patients in comparison to healthy donors: evidence for in vivo priming by tumor cells. J Immunother Emphasis Tumor Immunol 1996;19:26677.[Medline]cancerlit;97031815
9
Altman JD, Moss PA, Goulder PJ, Barouch DH, McHeyzer-Williams MG, Bell JI, et al. Phenotypic analysis of antigen-specific T lymphocytes. Science 1996;274:946.
10
Lee KH, Wang E, Nielsen MB, Wunderlich J, Migueles S, Connors M, et al. Increased vaccine-specific T cell frequency after peptide-based vaccination correlates with increased susceptibility to in vitro stimulation but does not lead to tumor regression. J Immunol 1999;163:6292300.
11 Scheibenbogen C, Lee KH, Stevanovic S, Witzens M, Willhauck M, Waldman V, et al. Analysis of the T cell response to tumor and viral peptide antigens by an IFNgamma-ELISPOT assay. Int J Cancer 1997;71:9326.[CrossRef][Web of Science][Medline]cancerlit;97329178
12 Pass HA, Schwarz SL, Wunderlich JR, Rosenberg SA. Immunization of patients with melanoma peptide vaccines: immunologic assessment using the ELISPOT assay. Cancer J Sci Am 1998;4:31623.[Medline]cancerlit;99035510
13
Tan LC, Gudgeon N, Annels NE, Hansasuta P, O'Callaghan CA, Rowland-Jones S, et al. A re-evaluation of the frequency of CD8+ T cells specific for EBV in healthy virus carriers. J Immunol 1999;162:182735.
14
Heid CA, Stevens J, Livak KJ, Williams PM. Real time quantitative PCR. Genome Res 1996;6:98694.
15 Kruse N, Pette M, Toyka K, Rieckmann P. Quantification of cytokine mRNA expression by RT PCR in samples of previously frozen blood. J Immunol Methods 1997;210:195203.[CrossRef][Web of Science][Medline]cancerlit;98179125
16 Player MA, Barracchini KC, Simonis TB, Rivoltini L, Arienti F, Castelli C, et al. Differences in frequency distribution of HLA-A2 subtypes between North American and Italian white melanoma patients: relevance for epitope specific vaccination protocols. J Immunother Emphasis Tumor Immunol 1996;19:35763.[Medline]cancerlit;97097061
17 Wei ML, Cresswell P. HLA-A2 molecules in an antigen-processing mutant cell contain signal sequence-derived peptides. Nature 1992;356:4436.[CrossRef][Medline]
18
Kammula US, Lee KH, Riker AI, Wang E, Ohnmacht GA, Rosenberg SA, et al. Functional analysis of antigen-specific T lymphocytes by serial measurement of gene expression in peripheral blood mononuclear cells and tumor specimens. J Immunol 1999;163:686775.
19 Rosenberg SA. Cancer vaccines based on the identification of genes encoding cancer regression antigens. Immunol Today 1997;18:17582.[CrossRef][Web of Science][Medline]cancerlit;97282207
20
Kawakami Y, Eliyahu S, Delgado CH, Robbins PF, Sakaguchi K, Appella E, et al. Identification of a human melanoma antigen recognized by tumor-infiltrating lymphocytes associated with in vivo tumor rejection. Proc Natl Acad Sci U S A 1994;91:645862.
21
Kawakami Y, Eliyahu S, Delgado CH, Robbins PF, Rivoltini L, Topalian SL, et al. Cloning of the gene coding for a shared human melanoma antigen recognized by autologous T cells infiltrating into tumor. Proc Natl Acad Sci U S A 1994;91:35159.
22
Coulie PG, Brichard V, Van Pel A, Wolfel T, Schneider J, Traversari C, et al. A new gene coding for a differentiation antigen recognized by autologous cytolytic T lymphocytes on HLA-A2 melanomas. J Exp Med 1994;180:3542.
23
Ogg GS, Jin X, Bonhoeffer S, Dunbar PR, Nowak MA, Monard S, et al. Quantitation of HIV-1-specific cytotoxic T lymphocytes and plasma load of viral RNA. Science 1998;279:21036.
24
Callan MF, Tan L, Annels N, Ogg GS, Wilson JD, O'Callaghan CA, et al. Direct visualization of antigen-specific CD8+ T cells during the primary immune response to Epstein-Barr virus In vivo. J Exp Med 1998;187:1395402.
25
Minev BR, McFarland BJ, Spiess PJ, Rosenberg SA, Restifo NP. Insertion signal sequence fused to minimal peptides elicits specific CD8+ T-cell responses and prolongs survival of thymoma-bearing mice. Cancer Res 1994;54:415561.
Manuscript received November 22, 1999; revised June 13, 2000; accepted June 15, 2000.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
C. J. Wheeler, K. L. Black, G. Liu, M. Mazer, X.-x. Zhang, S. Pepkowitz, D. Goldfinger, H. Ng, D. Irvin, and J. S. Yu Vaccination Elicits Correlated Immune and Clinical Responses in Glioblastoma Multiforme Patients Cancer Res., July 15, 2008; 68(14): 5955 - 5964. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. R. Lindsey, L. Gritz, R. Sherry, A. Abati, P. A. Fetsch, L. C. Goldfeder, M. I. Gonzales, K. A. Zinnack, L. Rogers-Freezer, L. Haworth, et al. Evaluation of Prime/Boost Regimens Using Recombinant Poxvirus/Tyrosinase Vaccines for the Treatment of Patients with Metastatic Melanoma Clin. Cancer Res., April 15, 2006; 12(8): 2526 - 2537. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Wheeler, A. Das, G. Liu, J. S. Yu, and K. L. Black Clinical Responsiveness of Glioblastoma Multiforme to Chemotherapy after Vaccination Clin. Cancer Res., August 15, 2004; 10(16): 5316 - 5326. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Yu, G. Liu, H. Ying, W. H. Yong, K. L. Black, and C. J. Wheeler Vaccination with Tumor Lysate-Pulsed Dendritic Cells Elicits Antigen-Specific, Cytotoxic T-Cells in Patients with Malignant Glioma Cancer Res., July 15, 2004; 64(14): 4973 - 4979. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Wheeler, K. L. Black, G. Liu, H. Ying, J. S. Yu, W. Zhang, and P. K. Lee Thymic CD8+ T Cell Production Strongly Influences Tumor Antigen Recognition and Age-Dependent Glioma Mortality J. Immunol., November 1, 2003; 171(9): 4927 - 4933. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Urosevic, T. Maier, B. Benninghoff, H. Slade, G. Burg, and R. Dummer Mechanisms Underlying Imiquimod-Induced Regression of Basal Cell Carcinoma In Vivo Arch Dermatol, October 1, 2003; 139(10): 1325 - 1332. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Rentzsch, S. Kayser, S. Stumm, I. Watermann, S. Walter, S. Stevanovic, D. Wallwiener, and B. Guckel Evaluation of Pre-existent Immunity in Patients with Primary Breast Cancer: Molecular and Cellular Assays to Quantify Antigen-Specific T Lymphocytes in Peripheral Blood Mononuclear Cells Clin. Cancer Res., October 1, 2003; 9(12): 4376 - 4386. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. D. Davis, M. Jefford, P. Parente, and J. Cebon Rational approaches to human cancer immunotherapy J. Leukoc. Biol., January 1, 2003; 73(1): 3 - 29. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Perez-Diez, P. J. Spiess, N. P. Restifo, P. Matzinger, and F. M. Marincola Intensity of the Vaccine-Elicited Immune Response Determines Tumor Clearance J. Immunol., January 1, 2002; 168(1): 338 - 347. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Ohnmacht, E. Wang, S. Mocellin, A. Abati, A. Filie, P. Fetsch, A. I. Riker, U. S. Kammula, S. A. Rosenberg, and F. M. Marincola Short-Term Kinetics of Tumor Antigen Expression in Response to Vaccination J. Immunol., August 1, 2001; 167(3): 1809 - 1820. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Schumacher, W. Haensch, C. Röefzaad, and P. M. Schlag Prognostic Significance of Activated CD8+ T Cell Infiltrations within Esophageal Carcinomas Cancer Res., May 1, 2001; 61(10): 3932 - 3936. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

) as well as postimmunization PBMCs alone (
) demonstrated no change (overlapping horizontal lines). Panel d: Two-hour exposure of the postimmunization majority of PBMCs (bottom panel) to increasing concentrations of the g209 peptide demonstrated optimal stimulation of expression of IFN 




