Skip Navigation

JNCI Journal of the National Cancer Institute 1999 91(5):469-473; doi:10.1093/jnci/91.5.469
© 1999 by Oxford University Press
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Request Permissions
Google Scholar
Right arrow Articles by Phillips, K.-A.
Right arrow Articles by Andrulis, I. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Phillips, K.-A.
Right arrow Articles by Andrulis, I. L.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Journal of the National Cancer Institute, Vol. 91, No. 5, 469-473, March 3, 1999
© 1999 Oxford University Press


REPORTS

Frequency of p53 Mutations in Breast Carcinomas From Ashkenazi Jewish Carriers of BRCA1 Mutations

Kelly-Anne Phillips, Kerrie Nichol, Hilmi Ozcelik, Julia Knight, Susan J. Done, Pamela J. Goodwin, Irene L. Andrulis

Affiliations of authors: K.-A. Phillips, Center for Cancer Genetics and Samuel Lunenfeld Research Institute of Mt. Sinai Hospital, and Department of Medical Oncology and Hematology, Princess Margaret Hospital, Toronto, ON, Canada; K. Nichol, Center for Cancer Genetics and Samuel Lunenfeld Research Institute of Mt. Sinai Hospital; H. Ozcelik, Center for Cancer Genetics and Samuel Lunenfeld Research Institute of Mt. Sinai Hospital, and Department of Laboratory Medicine and Pathobiology, University of Toronto; J. Knight, Division of Preventive Oncology, Cancer Care Ontario; S. J. Done, Samuel Lunenfeld Institute of Mt. Sinai Hospital, and Department of Laboratory Medicine and Pathobiology, University of Toronto; P. J. Goodwin, Samuel Lunenfeld Research Institute of Mt. Sinai Hospital and Marvelle Koffler Breast Center of Mt. Sinai Hospital; I. L. Andrulis, Center for Cancer Genetics and Samuel Lunenfeld Research Institute of Mt. Sinai Hospital, Department of Laboratory Medicine and Pathobiology and Department of Medical and Molecular Genetics, University of Toronto, and Division of Preventive Oncology, Cancer Care Ontario.

Correspondence to: Irene L. Andrulis, Ph.D., Center for Cancer Genetics, Samuel Lunenfeld Research Institute, Mt. Sinai Hospital, 600 University Ave., Toronto, ON M5G 1X5, Canada (e-mail: andrulis{at}mshri.on.ca).


    ABSTRACT
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
BACKGROUND: Breast carcinomas occurring in carriers of BRCA1 gene mutations may have a distinctly different pathway of molecular pathogenesis from those occurring in noncarriers. Data from murine models implicate loss of p53 (also known as TP53) gene function as a critical early event in the malignant transformation of cells with a BRCA1 mutation. Therefore, breast tumors from BRCA1 mutation carriers might be expected to exhibit a high frequency of p53 mutations. This study examined the frequency of p53 mutations in the breast tumors of Ashkenazi Jewish carriers and noncarriers of BRCA1 mutations. METHODS: Tumor DNA from carriers and noncarriers of BRCA1 mutations was screened for mutations in exons 4 through 10 of the p53 gene by use of the polymerase chain reaction and single-strand conformation polymorphism (SSCP) analysis of the amplified DNA. Direct sequencing was performed on gene fragments that showed altered mobility in SSCP analysis. RESULTS: Mutations in the p53 gene were detected in 10 of 13 tumors from BRCA1 mutation carriers versus 10 of 33 tumors from noncarriers (two-sided P = .007). The p53 mutations were distributed throughout exons 4 through 10 and included both protein-truncating and missense mutations in both groups. CONCLUSIONS: A statistically significantly higher frequency of p53 mutations was found in breast tumors from carriers of BRCA1 mutations than from noncarriers, which adds to the accumulating evidence that loss of p53 function is an important step in the molecular pathogenesis of BRCA1 mutation-associated breast tumors. This finding may have implications for understanding phenotypic differences and potential prognostic differences between BRCA1 mutation-associated hereditary breast cancers and sporadic cancers.



    INTRODUCTION
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
The presence of germline mutations in one allele of the autosomal dominant breast cancer predisposition gene BRCA1, followed by somatic loss of the other allele, accounts for a substantial proportion of hereditary breast cancers (1-4). However, cancer is a multistep process, and loss of functional Brca1 protein alone is not sufficient for tumorigenesis; several additional genetic abnormalities must also accumulate in a clonal population of breast epithelial cells for cancer to evolve. Somatic mutations in BRCA1 are extremely rare in sporadic breast cancer (5), which suggests that there may be distinct differences in the molecular pathogenesis of BRCA1-associated versus sporadic tumors. However, little is known about the other genetic perturbations that may arise and be selected for during tumor progression in cells that lack functional BRCA1.

Data from murine models suggest that the p53 gene (also known as TP53), which is involved in initiating cell cycle arrest and apoptosis in response to DNA damage, may be important in the molecular pathogenesis of BRCA1-associated tumors. The Brca1 protein interacts with the Rad51 protein, which is involved in recombination and DNA double-strand repair (6). A cell that lacks functional Brca1 protein may, therefore, have a decreased ability to repair DNA damage, resulting in increased genomic instability and ultimately leading to p53-mediated cell cycle arrest and/or apoptosis. In support of the latter suggestion, researchers (7,8) have observed that BRCA1-deficient mice die early in embryogenesis and exhibit paradoxically decreased cellular proliferation and increased expression of the p21 tumor suppressor gene. In addition, BRCA1-deficient mice can be partially rescued from early embryonic lethality by the presence of p53 or p21 null mutations (8). This finding suggests that loss of p53 checkpoint control may be obligatory for malignant transformation in cells with a BRCA1 mutation and that it must occur prior to the "second hit" in BRCA1, in order for BRCA1-/- cells to overcome cell cycle arrest. Loss of p53 checkpoint control in such a clonal cell population would enable the accumulation of the further somatic genetic abnormalities necessary for tumorigenesis. Breast carcinomas in patients who carry BRCA1 mutations might therefore be expected to exhibit a high rate of somatic p53 mutations.

Mutations in BRCA1 are distributed throughout the coding regions of the gene (9). However, in individuals of Ashkenazi Jewish descent, there are two common recurrent mutations in BRCA1 (185delAG and 5382insC) due to founder effects (10,11). The carrier rate for either of these mutations in this population is approximately 1.2% (11). An additional common, recurrent mutation, 6174delT, in a second breast cancer predisposition gene, BRCA2, has been found in approximately 1.5% of the unselected Jewish population (11). In Ontario, Canada, genetic testing for these mutations in BRCA1 and BRCA2 is currently offered to Ashkenazi Jewish women with a personal history of breast cancer, regardless of family history of breast cancer, in the context of a research protocol. As part of this protocol, archival specimens of each woman's breast tumor were collected. This study provided an opportunity to examine the frequency of p53 mutations in the breast tumors of an ethnically homogeneous population of carriers and noncarriers of mutations in BRCA1.


    SUBJECTS AND METHODS
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Subjects

This project was conducted as a substudy of an Ontario Familial Breast Cancer Registry (OFBCR) research protocol that is designed to investigate the prevalence of germline mutations in BRCA1 and BRCA2 among Ashkenazi Jewish women with a personal history of breast cancer. The parent protocol recruited and offered testing for the three common mutations described above, to breast cancer patients of Ashkenazi Jewish descent, seen at hospitals in Ontario, who were being followed because of their cancers. Individuals gave written informed consent to participate in the OFBCR research protocol, including consent for molecular studies of archival fresh-frozen or paraffin-embedded tumor specimens. The protocol was approved by the ethics committee of the University of Toronto.

Breast carcinomas from Ashkenazi Jewish women who were documented to have either the 185delAG or the 5382insC mutation in BRCA1 were considered to be "BRCA1-associated tumors." Those cancers from Ashkenazi Jewish women who were documented not to have any of the three recurrent mutations in BRCA1 or BRCA2 were considered to be "sporadic tumors." Tumors from Ashkenazi Jewish women with at least one first- or second-degree relative with breast or ovarian cancer were excluded from the "sporadic" group, to decrease the likelihood of inadvertently including in the cohort tumors from women with undetected germ-line mutations in BRCA1 or BRCA2 (i.e., mutations at sites other than the three tested for in the primary study). Data on tumor histopathology and steroid receptor status were collected from laboratory reports generated at the time of patient diagnosis.

DNA Extraction

In the case of paraffin-embedded samples, tumor pathology was reviewed and regions of tumor tissue were selected for dissection from paraffin blocks. Paraffin was removed from the 10-µm sections by being soaked first in xylene and then in increasing concentrations of ethanol. After briefly staining with hematoxylin, the tumor was microdissected from each slide into 60 µL of lysis buffer (10 mM Tris-HCl [pH 8.0], 100 mM KCl, 2.5 mM MgCl2, 0.45% Tween 20, and 2.5 mg/mL proteinase K), and then digested at 65 °C overnight. The proteinase K was then inactivated by heating the samples to 95 °C for 10 minutes.

Fresh tumor samples were flash-frozen in liquid nitrogen immediately after surgery. DNA was extracted from the crushed, thawed tumor samples after incubation at 37 °C overnight in 0.5% sarkosyl, 10 mM EDTA, 10 mM Tris-HCl (pH 8.0), 7.5 mM NaCl, and 400 µg/mL proteinase K by use of a standard phenol/chloroform extraction (12). The DNA was resuspended in 10 mM Tris-HCl (pH 8.0).

p53 Mutation Analysis

The individuals performing p53 mutation analysis were blinded to the BRCA1 germline mutation status of the tumors. Genomic DNA (100 ng of fresh-frozen samples and 2 µL of paraffin-embedded samples) was used as a template to amplify exons 4 through 10 of p53, and flanking intronic sequences, by polymerase chain reaction (PCR). Single-strand conformation polymorphism (SSCP) analysis was used to screen for mutations. Prior experience with this technique in our laboratory has shown it to be highly sensitive for detecting p53 mutations when compared with immunohistochemistry (13). Exons 5 through 9 were amplified by use of previously described primer sets (14,15), with some changes in amplification conditions. Exon 4 was amplified in two segments (4A and 4B), to amplify fragments of the appropriate size for SSCP analysis. Primer sequences for exons 4A, 4B, and 10 are as follows: exon 4AF 5'TCCTCTGACTGCTCTTTTCAC 3'; exon 4AR 5'GGAAGGGACAGAAGATGACAG 3'; exon 4BF 5'CCCCTGCACCAGCAGCTCCTA 3'; exon 4BR 5'CAGGCATTGAAGTCTCATGG 3'; exon 10F 5'AACTCAGGTACTGTGAATATACT 3'; exon 10R 5'GGGGAGTAGGGCCAGTAAGG 3'. All exons were amplified in 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 2 mM MgCl2, 200 µM of each deoxynucleoside triphosphate (dNTP), 0.3 µM of each primer (i.e., 0.3 µM of the relevant reverse and relevant forward primer), 0.1 µL [{alpha}-33P]dATP (10 mCi/µL), and 2 U of Amplitaq (Perkin-Elmer Cetus, Norwalk, CT) in a total volume of 25 µL. For exons 5, 6, 8, and 9, the samples were placed in a GeneAmp 9600 thermal cycler (The Perkin-Elmer Corp., Foster City, CA) and cycled (fresh-frozen samples for 35 cycles and paraffin-embedded samples for 45 cycles) at 94 °C for 15 seconds, 52 °C for 15 seconds, and 72 °C for 20 seconds. The annealing temperature was 58 °C for exons 4B and 7 and 55 °C for exons 4A and 10. SSCP analysis of amplified samples was performed by use of glycerol-containing polyacrylamide gels, as described previously (13,16).

Amplified gene fragments that showed different migration patterns upon SSCP analysis were subjected to direct sequencing to confirm and characterize the mutations. Genomic DNA was reamplified by use of the conditions described above. The PCR product was purified with the use of Microcon 100 columns (Amicon, Inc., Beverly, MA). The purified product was sequenced with the use of the Thermo Sequenase radiolabeled terminator cycle sequencing kit (Amersham Life Science Inc., Cleveland, OH). The labeled product was then subjected to electrophoresis by use of a 6% denaturing polyacrylamide gel. All mutations detected were subsequently confirmed by reamplifying genomic DNA (which, in the case of paraffin-embedded samples, was extracted by microdissection of a second tumor slide), followed by sequencing of the amplified product.

Statistical Analysis

Two-tailed Fisher's exact tests were used to examine the relationship between BRCA1 and categorical variables such as tumor grade. A two-tailed t test was used to evaluate age differences between BRCA1 carriers and noncarriers. All P values are two-sided and are considered statistically significant for P<.05.


    RESULTS
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
In total, 46 breast carcinomas were analyzed, including 13 BRCA1-associated tumors (11 from carriers of the 185delAG mutation and two from carriers of the 5382insC mutation). As shown in Table 1,Go tumors from BRCA1 carriers were statistically significantly more frequently of histologic grade 3 (12 of 13 tumors versus 18 of 33 tumors; P = .02) and estrogen receptor negative (nine of 11 tumors versus 12 of 30 tumors, for the 41 tumors in which estrogen receptor status was known; P = .03), and they were diagnosed at a younger age (mean age, 47.5 years [95% confidence interval = 39.1-55.9 years] versus 57.5 years [95% confidence interval = 54.0-61.0 years]; P = .009).


View this table:
[in this window]
[in a new window]
 
Table 1. Tumor characteristics

 
Mutations in p53 were detected in a total of 20 tumors (43%): Ten of 13 were in BRCA1-associated tumors compared with 10 of 33 in sporadic tumors (P = .007). Because of the strikingly high frequency of mutations in the group of BRCA1-associated tumors, exons 4 through 10 of p53 were subsequently sequenced for the three tumors without SSCP shifts; however, no mutations were detected in these samples. All but two of the tumors analyzed were from unrelated individuals; the remaining two BRCA1-associated tumors were from a mother-daughter pair. The tumors from these two individuals were documented to have different somatic p53 mutations (Table 2),Go making it unlikely that there was some unknown familial factor affecting their p53 mutation status. However, even if one of these individuals is excluded from the analysis, the higher frequency of p53 mutation in the BRCA1-associated tumors remains significant (P = .015).


View this table:
[in this window]
[in a new window]
 
Table 2. p53 mutations found in tumors from BRCA1 carriers

 
The p53 mutations found in this study are detailed in Tables 2 and 3.GoGo Mutations were distributed throughout exons 4 through 10, and the majority of mutations occurred in the DNA-binding domain (exons 5 through 8). In one BRCA1-associated tumor (sample 7), two mutations were documented: a missense mutation in exon 8 and a single-base-pair substitution in intron 6, six base pairs upstream from exon 7. Most of the observed mutations were single-base-pair substitutions (nine transitions and seven transversions), and the remainder consisted of 1- or 2-base-pair insertions or deletions. There were 13 mutations (65%) that were predicted to result in truncation of p53 protein and seven that were classified as missense mutations (35%). The functional importance of the mutation in intron 6 is unknown, and this mutation has not been reported previously. The number of tumors with p53 mutations in each group was too small to make meaningful comparisons with regard to the distribution and type of mutations. However, apart from an excess of protein-truncating mutations in the sporadic group, there were no striking differences between the group of BRCA1-associated tumors and the sporadic tumors.


View this table:
[in this window]
[in a new window]
 
Table 3. p53 mutations found in sporadic tumors

 

    DISCUSSION
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
This study compared the frequency of p53 mutations in BRCA1-associated breast carcinomas with that in sporadic breast tumors in a prevalence sample of Ashkenazi Jewish women. Mutations in p53 were found to be significantly more frequent in the BRCA1-associated tumors (10 of 13 tumors versus 10 of 33 tumors; P = .007). The rate of p53 mutations in the sporadic tumor group was similar to that found in a previous study (17). There were statistically significant differences in the tumor characteristics between the two groups. BRCA1-associated tumors were diagnosed at an earlier mean age, were more likely to be of histologic grade 3, and were more frequently estrogen receptor negative. These differences have been found consistently in studies of BRCA1-associated tumors (18-24) and, therefore, are unlikely to reflect a bias in tumor selection but rather may reflect differences in the underlying molecular pathways. In fact, the finding of a higher frequency of p53 mutations in the BRCA1-associated tumors may provide a molecular explanation for the higher cell proliferation rates seen in this group.

The high frequency of p53 mutations found in the BRCA1-associated tumors is in keeping with the postulate derived from animal models that loss of p53 checkpoint control is important in the molecular pathogenesis of breast carcinomas in carriers of BRCA1 mutations (7,8). However, in three of the BRCA1-associated tumors in this study, a p53 mutation was not documented with either SSCP analysis or direct sequencing. It is possible that there are undetected mutations in those samples; alternatively, these tumors may have alterations in other genes involved in the p53 checkpoint mechanism or large chromosomal deletions involving the p53 locus.

Crook et al. (25) also found a very high frequency of p53 mutations in BRCA1-associated breast cancers; however, these mutations were clustered in exon 5 of p53 (six of seven tumors). This finding contrasts with the observations made in the current study, in which p53 mutations in the BRCA1-associated tumors were distributed throughout the coding region of the gene. A high frequency of p53 mutations has also been documented by Rhei et al. (26) in ovarian cancers that are associated with germline mutations in either BRCA1 or BRCA2. This finding is difficult to interpret because of the well-documented high frequency of p53 mutations in sporadic ovarian cancers and because of the fact that a comparative control group of sporadic tumors was not studied concurrently. However, in the study by Rhei et al. (26), the spectrum of p53 mutations was similar to that seen for BRCA1-associated breast tumors in the current study, with a predominance of missense mutations that were found mainly in the DNA-binding domain.

The high frequency of p53 mutations seen in BRCA1-associated tumors may have implications for prognosis. Mutation in p53 has been shown in a number of studies [reviewed in (27)] to correlate with poorer prognosis in breast cancer, although not always as an independent variable. Paradoxically, some small studies (20,23,28-30) have suggested an improved or equivalent prognosis for BRCA1-associated tumors compared with sporadic tumors, although these studies had methodologic features that may have introduced bias. It will be important to study prognosis and associated molecular markers, such as p53, in a population-based prospective study of women that includes BRCA1 mutation carriers.

In conclusion, our results provide indirect evidence that loss of p53 checkpoint control may be a critical event in the pathogenesis of BRCA1-associated tumors. Further studies of the molecular characteristics of these tumors will be important. Understanding the inherent molecular differences between BRCA1-associated breast tumors and sporadic breast tumors may provide insight into the documented phenotypic differences and the possible differences in prognosis and response to treatment between the two groups.


    NOTES
 
Supported by the Canadian Breast Cancer Foundation, the Canadian Breast Cancer Research Initiative, and with resources from the Cooperative Family Registry for Breast Cancer Studies (Public Health Service grant U01CA69467 from the National Cancer Institute, National Institutes of Health, Department of Health and Human Services). S. J. Done receives support from the National Cancer Institute of Canada, with funds provided by the Terry Fox Run.

We thank Judy Morell and Patricia Wilkins for their assistance in obtaining tumor samples and clinical data. We also acknowledge the Ontario Cancer Genetics Network and sincerely thank all of the participants in this study.


    REFERENCES
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 

1 Miki Y, Swensen J, Shattuck-Eidens D, Futreal PA, Harshman K, Tavtigian S, et al. A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1. Science 1994;266:66-71.[Abstract/Free Full Text]cancerlit;95025896

2 Ford D, Easton DF, Bishop DT, Narod SA, Goldgar DE. Risks of cancer in BRCA1-mutation carriers. Breast Cancer Linkage Consortium. Lancet 1994;334:692-5.

3 Easton DF, Ford D, Bishop DT. Breast and ovarian cancer incidence in BRCA1-mutation carriers. Breast Cancer Linkage Consortium. Am J Hum Genet 1995;56:265-71.[ISI][Medline]cancerlit;95126121

4 Szabo CI, King MC. Population genetics of BRCA1 and BRCA2 [editorial]. Am J Hum Genet 1997;60:1013-20.[ISI][Medline]cancerlit;97294392

5 Futreal PA, Liu Q, Shattuck-Eidens D, Cochran C, Harshman K, Tavtigian S, et al. BRCA1 mutations in primary breast and ovarian carcinomas. Science 1995;266:120-2.

6 Scully R, Chen J, Plug A, Xiao Y, Weaver D, Feunteun J, et al. Association of BRCA1 with Rad51 in mitotic and meiotic cells. Cell 1997;88:265-75.[CrossRef][ISI][Medline]cancerlit;97160847

7 Hakem R, de la Pompa JL, Sirard C, Mo R, Woo M, Hakem A, et al. The tumor suppressor gene Brca1 is required for embryonic cellular proliferation in the mouse. Cell 1996;85:1009-23.[CrossRef][ISI][Medline]cancerlit;96270504

8 Ludwig T, Chapman DL, Papaioannou VE, Efstratiadis A. Targeted mutations of breast cancer susceptibility gene homologs in mice: lethal phenotypes of Brca1, Brca2, Brca1/Brca2, Brca1/p53, and Brca2/p53 nullizygous embryos. Genes Dev 1997;11: 1226-41.[Abstract/Free Full Text]cancerlit;97315194

9 Breast Cancer Information core [BIC] database on the World Wide Web at http://www.nhgri.nih.gov/Intramural_research/Lab_transfer/Bic/

10 Struewing JP, Abeliovich D, Peretz T, Avishai N, Kaback MM, Collins FS, et al. The carrier frequency of the BRCA1 185delAG mutation is approximately 1 percent in Ashkenazi Jewish individuals [published erratum appears in Nat Genet 1996;12:110]. Nat Genet 1995;11:198-200.[CrossRef][ISI][Medline]cancerlit;96024657

11 Roa BB, Boyd AA, Volcik K, Richards CS. Ashkenazi Jewish population frequencies for common mutations in BRCA1 and BRCA2. Nat Genet 1996;14:185-7.[CrossRef][ISI][Medline]cancerlit;96438856

12 Blin N, Stafford DW. A general method for isolation of high molecular weight DNA from eukaryotes. Nucleic Acids Res 1976;9:2303-8.

13 Mousses S, McAuley L, Bell RS, Kandel R, Andrulis IL. Molecular and immunohistochemical identification of p53 alterations in bone and soft tissue sarcomas. Mod Pathol 1996;9:1-6.[ISI][Medline]cancerlit;96419175

14 Kovach JS, McGovern RM, Cassady JD, Swanson SK, Wold LE, Vogelstein B, et al. Direct sequencing from touch preparations of human carcinomas: analysis of p53 mutations in breast carcinomas. J Natl Cancer Inst 1991;83:1004-9.[Abstract/Free Full Text]cancerlit;91303594

15 Ozcelik H, Andrulis IL. Multiplex PCR-SSCP for simultaneous screening for mutations in several exons of p53. Biotechniques 1995;18:742-4.[ISI][Medline]cancerlit;95344712

16 Orita M, Suzuki Y, Sekiya T, Hayashi K. Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics 1989;5:874-9.[CrossRef][ISI][Medline]cancerlit;90077429

17 Soussi T, Legros Y, Lubin R, Ory K, Schlichtholz B. Multifactorial analysis of p53 alteration in human cancer: a review. Int J Cancer 1994;57:1-9.[ISI][Medline]cancerlit;94200874

18 Armes JE, Egan AJ, Southey MC, Dite GS, McCredie MR, Giles GG, et al. The histologic phenotypes of breast carcinoma occurring before age 40 years in women with and without BRCA1 or BRCA2 germline mutations: a population-based study. Cancer 1998;83:2335-45.[CrossRef][ISI][Medline]cancerlit;99054268

19 Phillips KA. Breast carcinoma in carriers of BRCA1 or BRCA2 mutations: implications of proposed distinct histologic phenotypes [editorial]. Cancer 1998;83:2251-4.[CrossRef][ISI][Medline]cancerlit;99054258

20 Breast Cancer Linkage Consortium. Pathology of familial breast cancer: differences between breast cancers in carriers of BRCA1 or BRCA2 mutations and sporadic cases. Lancet 1997;349:1505-10.[CrossRef][ISI][Medline]cancerlit;97310292

21 Robson M, Gilewski T, Haas B, Levin D, Borgen P, Rajan P, et al. BRCA-associated breast cancer in young women. J Clin Oncol 1998;16:1642-9.[Abstract]cancerlit;98246285

22 Karp SE, Tonin PN, Begin LR, Martinez JJ, Zhang JC, Pollack MN, et al. Influence of BRCA1 mutations on nuclear grade and estrogen receptor status of breast carcinoma in Ashkenazi Jewish women. Cancer 1997;80:435-41.[CrossRef][ISI][Medline]cancerlit;97383086

23 Verhoog LC, Brekelmans CT, Seynaeve C, van den Bosch LM, Dahmen G, van Geel AN, et al. Survival and tumour characteristics of breast-cancer patients with germline mutations of BRCA1. Lancet 1998;351:316-21.[CrossRef][ISI][Medline]cancerlit;98314719

24 Johannsson OT, Idvall I, Anderson C, Borg A, Barkardottir RB, Egilsson V, et al. Tumor biological features of BRCA1-induced breast and ovarian cancer. Eur J Cancer 1997;33:362-71.cancerlit;97300497

25 Crook T, Crossland S, Crompton MR, Osin P, Gusterson BA. P53 mutations in BRCA1-associated familial breast cancer [letter]. Lancet 1997;350:638-9.[ISI][Medline]cancerlit;97434166

26 Rhei E, Bogomolniy F, Federici MG, Maresco DL, Offit K, Robson ME, et al. Molecular genetic characterization of BRCA1- and BRCA2-linked hereditary ovarian cancers. Cancer Res 1998;58:3193-6.[Abstract/Free Full Text]cancerlit;98363220

27 Elledge RM, Allred DC. The p53 tumor suppressor gene in breast cancer. Breast Cancer Res Treat 1994;32:39-47.[CrossRef][ISI][Medline]cancerlit;95119414

28 Porter DE, Cohen BB, Wallace MR, Smyth E, Chetty U, Dixon JM, et al. Breast cancer incidence, penetrance and survival in probable carriers of BRCA1 gene mutation in families linked to BRCA1 on chromosome 17q12-21. Br J Surg 1994;81:1512-5.[ISI][Medline]cancerlit;95120404

29 Marcus JN, Watson P, Page DL, Narod SA, Lenoir GM, Tonin P, et al. Hereditary breast cancer: pathobiology, prognosis, and BRCA1 and BRCA2 gene linkage. Cancer 1996;77:697-709.[CrossRef][ISI][Medline]cancerlit;96186854

30 Johannsson OT, Ranstam J, Borg A, Olsson H. Survival of BRCA1 breast and ovarian cancer patients: a population-based study from southern Sweden. J Clin Oncol 1998;16:397-404.[Abstract]cancerlit;98129223

Manuscript received September 11, 1998; revised December 21, 1998; accepted December 31, 1998.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Molecular Cancer TherapeuticsHome page
R. I. Yarden and M. Z. Papa
BRCA1 at the crossroad of multiple cellular pathways: approaches for therapeutic interventions.
Mol. Cancer Ther., June 1, 2006; 5(6): 1396 - 1404.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
J D Fackenthal, L Sveen, Q Gao, E K Kohlmeir, C Adebamowo, T O Ogundiran, A A Adenipekun, R Oyesegun, O Campbell, C Rotimi, et al.
Complete allelic analysis of BRCA1 and BRCA2 variants in young Nigerian breast cancer patients
J. Med. Genet., March 1, 2005; 42(3): 276 - 281.
[Full Text] [PDF]


Home page
J. Gerontol. B Psychol. Sci. Soc. Sci.Home page
M. K. McClintock, S. D. Conzen, S. Gehlert, C. Masi, and F. Olopade
Mammary Cancer and Social Interactions: Identifying Multiple Environments That Regulate Gene Expression Throughout the Life Span
J. Gerontol. B. Psychol. Sci. Soc. Sci., March 1, 2005; 60(suppl_Special_Issue_1): 32 - 41.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. S. Greenblatt, P. O. Chappuis, J. P. Bond, N. Hamel, and W. D. Foulkes
TP53 Mutations in Breast Cancer Associated with BRCA1 or BRCA2 Germ-line Mutations: Distinctive Spectrum and Structural Distribution
Cancer Res., May 1, 2001; 61(10): 4092 - 4097.
[Abstract] [Full Text]


Home page
Clin. Cancer Res.Home page
R. E. Buller, T. A. Lallas, M. S. Shahin, A. K. Sood, M. Hatterman-Zogg, B. Anderson, J. I. Sorosky, and P. A. Kirby
The p53 Mutational Spectrum Associated with BRCA1 Mutant Ovarian Cancer
Clin. Cancer Res., April 1, 2001; 7(4): 831 - 838.
[Abstract] [Full Text]


Home page
JNCI J Natl Cancer InstHome page
S. A. Narod and M.-P. Dube
Re: Biologic Characteristics of Interval and Screen-Detected Breast Cancers
J Natl Cancer Inst, January 17, 2001; 93(2): 151 - 151.
[Full Text] [PDF]


Home page
JCOHome page
K.-A. Phillips
Immunophenotypic and Pathologic Differences Between BRCA1 and BRCA2 Hereditary Breast Cancers
J. Clin. Oncol., November 1, 2000; 18(90001): 107s - 112.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
M. Esteller, J. M. Silva, G. Dominguez, F. Bonilla, X. Matias-Guiu, E. Lerma, E. Bussaglia, J. Prat, I. C. Harkes, E. A. Repasky, et al.
Promoter Hypermethylation and BRCA1 Inactivation in Sporadic Breast and Ovarian Tumors
J Natl Cancer Inst, April 5, 2000; 92(7): 564 - 569.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
M. Robson, D. Levin, M. Federici, J. Satagopan, F. Bogolminy, A. Heerdt, P. Borgen, B. McCormick, C. Hudis, L. Norton, et al.
Breast Conservation Therapy for Invasive Breast Cancer in Ashkenazi Women With BRCA Gene Founder Mutations
J Natl Cancer Inst, December 15, 1999; 91(24): 2112 - 2117.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Request Permissions
Google Scholar
Right arrow Articles by Phillips, K.-A.
Right arrow Articles by Andrulis, I. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Phillips, K.-A.
Right arrow Articles by Andrulis, I. L.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?