JNCI Journal of the National Cancer Institute

JNCI Journal of the National Cancer Institute 1999 91(22):1956-1960; doi:10.1093/jnci/91.22.1956
© 1999 by Oxford University Press

This Article Abstract FREE Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Add to My Personal Archive Download to citation manager Request Permissions Google Scholar Articles by Pajonk, F. Articles by McBride, W. H. Search for Related Content PubMed PubMed Citation Articles by Pajonk, F. Articles by McBride, W. H. Social Bookmarking          What's this?

Journal of the National Cancer Institute, Vol. 91, No. 22, 1956-1960, November 17, 1999
© 1999 Oxford University Press

REPORTS

Inhibition of NF-B, Clonogenicity, and Radiosensitivity of Human Cancer Cells

Frank Pajonk, Katja Pajonk, William H. McBride

Affiliation of authors: Department of Radiation Oncology, Experimental Division, University of California at Los Angeles School of Medicine.

Correspondence to: Frank Pajonk, M.D., Ph.D., Department of Radiation Oncology, Roy E. Coats Research Laboratories, University of California at Los Angeles School of Medicine, 10833 Le Conte Ave., Los Angeles, CA 90095-1714 (e-mail: fpajonk{at}ucla.edu).

	ABSTRACT

Top Abstract Introduction Materials and Methods Results and Discussion References

 
BACKGROUND: Activation of the transcription factor NF-B is part of the immediate early response of tissues to ionizing irradiation. This pathway has been shown to protect cells from tumor necrosis factor-, chemotherapy, and radiation therapy-induced apoptosis (programmed cell death). However, because the role of NF-B as a modifier of the intrinsic radiosensitivity of cancer cells is less clear, we have studied the impact of NF-B on the intrinsic radiosensitivity of human cancer cells. METHODS: We used PC3 prostate cancer cells and HD-MyZ Hodgkin's lymphoma cells transduced with an adenovirus vector that contains a gene encoding a form of IB (an inhibitor of NF-B) that cannot be phosphorylated. This form of IB will remain bound to NF-B; thus, NF-B cannot be activated. We monitored NF-B activity with a gel-shift assay and used a colony-forming assay to assess clonogenicity and radiosensitivity. RESULTS: Constitutive DNA-binding activity of NF-B was dramatically decreased in PC3 cells transduced with the IB super-repressor gene. The clonogenicity of transduced PC3 cells declined to 19.6% of that observed for untreated control cells, a finding similar to one we have previously demonstrated for IB-transduced HD-MyZ cells. However, inhibition of NF-B activity in the surviving PC3 and HD-MyZ cells failed to alter their intrinsic radiosensitivity. CONCLUSIONS: We conclude that activation of NF-B does not determine the intrinsic radiosensitivity of cancer cells, at least for the cell lines tested in this study.

---

	INTRODUCTION

Top Abstract Introduction Materials and Methods Results and Discussion References

 
The immediate early response of mammalian cells to ionizing irradiation includes activation of transcription factors, such as AP-1, p53 (also known as TP53), and NF-B (1,2). NF-B activation is an obligatory step (3), leading to expression of almost all genes involved in the inflammatory response generated by irradiation (4), as for other proinflammatory signals.

Activation of NF-B does not require protein synthesis. Homodimers and heterodimers of its subunits p50, p52, p65/RelA, c-Rel, and Rel-B are located in the cytosol preformed and bound to inhibitor molecules of the IB family (IB, IBß, IB, Bcl-3, p100, and p105). Activation of NF-B requires that IB is phosphorylated at two serine residues (Ser-32 and Ser-36) by IB kinases, polyubiquitinated, and subsequently degraded by the 26S proteasome. This process frees NF-B for translocation to the nucleus and activation of its target genetic programs [reviewed in (5)].

Although it is widely accepted that ionizing irradiation can cause a typical inflammatory response by activating NF-B, the role of this transcription factor as a survival factor for cells after ionizing irradiation remains unclear. In general, activation of NF-B has been reported to protect cells from apoptosis (programmed cell death) (6-8). However, this is not always the case; cells from patients with ataxia telangiectasia are one exception (9). Although radiation therapy-induced apoptosis has been reported to be associated with radiotherapeutic cure of murine tumors (10,11), its contribution in radiation therapy remains controversial. In most cases, cells in a tumor survive initial damage caused by therapeutic doses of radiation therapy and traverse several cell cycles before finally dying or producing clonogenic survivors (12) that cause tumor recurrence. The success of cancer treatment depends mainly on eliminating these tumor stem cells, by whatever pathway.

Activation of NF-B and consequent inhibition of apoptosis might be expected a priori to increase cell survival after irradiation, but the possible relationships of these events to the elimination of clonogenic stem cells after irradiation need further clarification. In this study, we investigated the role of NF-B in modulating the intrinsic radiosensitivity of two human cancer cells lines, PC3 prostate cancer cells and HD-MyZ Hodgkin's lymphoma cells. These cell lines were chosen because, for different reasons, they have high constitutive levels of NF-B that might confer relatively high resistance to radiation therapy.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results and Discussion References

 
Cell Culture

Cultures of PC3 human prostate carcinoma (American Type Culture Collection, Manassas, VA) and of the Hodgkin's cell line HD-MyZ (DSMZ, Braunschweig, Germany) were grown in 75-cm² flasks (Falcon Becton Dickinson and Co., Lincoln Park, NJ)) at 37 °C in a humidified atmosphere of 5% CO₂-95% air. Dulbecco's modified Eagle medium (Life Technologies, Inc. [GIBCO BRL], Gaithersburg, MD) was used supplemented with 10% fetal calf serum and 1% penicillin-streptomycin (Life Technologies, Inc.).

Transduction Experiments

The recombinant replication-deficient adenoviruses Ad5-IB and Ad5-LacZ were provided by R. Batra (University of California/West Los Angeles-Veterans Administration Medical Center). The vectors had been generated and quality tested at the Vector Core at the Gene Therapy Center of the University of North Carolina School of Medicine and are described elsewhere (13). Ad5-IB contains a gene for IB, an NF-B superrepressor, under control of a cytomegalovirus promoter/enhancer. The encoded IB contains serine-to-alanine mutations at positions 32 and 36, preventing the phosphorylation, ubiquitination, and subsequent degradation by the proteasome. Ad5-LacZ is a control virus that contains the gene for ß-galactosidase instead of IkB. Cells were plated in 10-cm culture dishes (Falcon Becton Dickinson and Co.). After 24 hours, the medium was changed and viral vectors containing the nonphosphorable IB or ß-galactosidase gene were added at a multiplicity of infection (MOI) of 1000. After 2 hours of incubation, the virus-containing medium was replaced by fresh medium, and cells were incubated for an additional 48 hours to allow gene expression. Successful transduction was confirmed by staining with 5-bromo-4-chloro-3-indolyl ß-D-galactoside.

Irradiation

PC3 cells were trypsinized, counted, and diluted to a final concentration of 10⁶ cells/mL. HD-MyZ cells were dislodged mechanically, counted, and diluted to a final concentration of 10⁶ cells/mL. The cell suspensions were immediately irradiated at room temperature with a ¹³⁷Cs laboratory irradiator (Mark I; J. L. Shepherd and Associates, San Fernando, CA) at a dose rate of 580 rads/minute. Corresponding control cells were sham irradiated.

Cell Extracts and Electrophoretic Mobility Shift Assays

For preparation of total cellular extracts, normal and treated cells were dislodged mechanically, washed with ice-cold phosphate-buffered saline (PBS), and lysed in TOTEX buffer (20 mM HEPES [pH 7.9], 0.35 mM NaCl, 20% glycerol, 1% Nonidet P-40 [NP40], 0.5 mM EDTA, 0.1 mM ethylene glycol-bis(ß-aminoethylether)-N,N,N',N'-tetraacetic acid, 0.5 mM dithiothreitol [DTT], 50 µM phenylmethylsulfonyl fluoride [PMSF], and aprotinin [90 trypsin inhibitor U/mL]) for 30 minutes on ice. Lysate was centrifuged at 12 000g for 5 minutes at 4 °C. Protein concentration was determined with the BCA protocol (Pierce Chemical Co., Rockford, IL). Fifteen micrograms of protein from the resulting supernatant was incubated for 25 minutes at room temperature with 2 µL of bovine serum albumin (10 µg/µL), 2 µL of poly[d(I-C)] [poly-deoxyinosinic-deoxycytidylic acid] (1 µg/µL), 4 µL of Ficoll buffer (20% Ficoll 400, 100 mM HEPES, 300 mM KCl, 10 mM DTT, and 0.1 mM PMSF), 2 µL of buffer D+ (20 mM HEPES, 20% glycerol, 100 mM KCl, 0.5 mM EDTA, 0.25% NP40, 2 mM DTT, and 0.1 mM PMSF), and 1 µL of the [-³²P]adenosine triphosphate-labeled oligonucleotide (Promega Corp., Madison, WI; NF-B: AGTTGAGGGGACTTTCCCAGG). For a negative control, unlabeled oligonucleotide was added to 50-fold excess. Gel analysis was carried out in native 4% polyacrylamide/0.5x TBE (Tris-boric acid-EDTA) gels. Dried gels were placed on a phosphor screen for 24 hours and analyzed on a phosphor imager (Storm 860; Molecular Dynamics, Sunnyvale, CA).

Clonogenic Survival

Colony-forming assays were performed immediately after irradiation by plating an appropriate number of cells into culture dishes in triplicate. After 14 days, cells were fixed and stained with crystal violet, and the number of colonies containing more than 50 cells were counted. The surviving fraction was normalized to the surviving fraction of the corresponding control, and survival curves were fitted by use of a linear-quadratic model.

Determination of Apoptosis

Apoptotic cells were detected with an In Situ Cell Death Kit (Boeringer Mannheim GmbH, Mannheim, Germany). The manufacturer's protocol was followed with some minor modifications. Briefly, attached and detached cells were collected, centrifuged at 500g for 5 minutes at 4 °C, fixed in ice-cold 75% ethanol, washed with PBS, and pelleted by centrifugation at 500g for 5 minutes at 4 °C. Cells were permeabilized by resuspension in a solution of 0.1% Triton X-100 and 0.1% sodium citrate and incubated for 2 minutes on ice. Cells were washed twice in PBS, resuspended in TUNEL (terminal deoxynucleotidyltransferase-mediated-uridine triphosphate nick-end labeling) reaction mixture, and incubated for 60 minutes at 37 °C. After three washes with PBS, fluorescence was measured at 518 nm in a flow cytometer (FACScan System; Becton Dickinson Immunocytometry Systems, San Jose, CA) and analyzed with the CellQuest software (Becton Dickinson Immunocytometry Systems).

Statistics

All data are means ± 95% confidence intervals. A P value of <.05 from Student's t test was considered to be statistically significant. All statistical analyses were carried out with the JMP (version 3.2) software package from SAS (SAS Institute, Inc., Cary, NC) for Macintosh. All P values are two-sided.

	RESULTS AND DISCUSSION

Top Abstract Introduction Materials and Methods Results and Discussion References

 
We have recently shown that PC3 prostate cancer cells contain high levels of constitutive NF-B activity, almost five times higher than HD-MyZ Hodgkin's cells under comparable conditions. In PC3 cells, high constitutive NF-B activity is, at least in part, due to a high level of 26S proteasome activity (Pajonk F, Pajonk K, McBride WH: unpublished results). In HD-MyZ cells, NF-B is also constitutively active, although the reason remains unclear (14).

As we have shown for HD-MyZ cells (Pajonk F, Pajonk K, McBride WH: unpublished results), adenoviral vectors were highly efficient at inserting genes into PC3 prostate cancer cells. Transduction rates in excess of 99%, confirmed by staining with 5-bromo-4-chloro-3-indolyl-ß-D-galactoside, were achieved at a MOI of 1000 (data not shown). This MOI caused no visible transduction-related toxicity after 48 hours, but when PC3 cells transduced with the control vector were trypsinized and replated at that time, their plating efficiency was slightly reduced to 29.5% ± 0.24% (78% of the nontransduced control level [37.9% ± 5.63%]; P = .11; Student's t test). However, the clonogenicity of cells transduced with the adenoviral vector containing the IB superrepressor gene was greatly reduced to 7.4% ± 2.67% (19.6% of the nontransduced control level; P = .010; Student's t test; Fig. 1, A). These findings are almost identical to our results for HD-MyZ cells (Pajonk F, Pajonk K, McBride WH: unpublished results).

View larger version (29K): [in this window] [in a new window]   Fig. 1. A) Clonogenicity of PC3 prostate cancer cells after transduction with an IB super-repressor gene (Ad5-IkB) or a gene for ß-galactosidase (Ad5-LacZ) assessed by plating efficiency (PE) in a colony-forming assay. Error bars = 95% confidence interval. *Two-sided P = .010 versus control. B) Flow cytometric analysis of apoptosis in Ad5-IkB-transduced PC3 cells, replated 48 hours after transduction. Twenty-four hours after replating, PC3 cells were analyzed with a TUNEL (terminal deoxynucleotidyltransferase-mediated-uridine triphosphate nick-end labeling) assay. Transduction increased the apoptotic fraction from initially 15% (untreated control cells) to 73% (multiplicity of infection [MOI] = 100) and 90% (MOI = 1000) 24 hours after replating. Solid areas = control cells; open areas = transduced cells. FL1-H = intensity of the fluorescence signal (excitation = 488 nm/emission = 518 nm).

 
After 24 hours, 16% of nontransduced PC3 cells had entered apoptosis. Cells transduced with the IB superrepressor gene had an increased apoptotic index of 73% (MOI = 100) and 90% (MOI = 1000) (Fig 1, B).

DNA-binding activity of NF-B in HD-MyZ cells has been reported to be high in comparison to other tumor cell lines (14) because of mutated IB. We had previously shown that NF-B levels in HD-MyZ cells decreased after transduction with the IB super-repressor gene (Pajonk F, Pajonk K, McBride WH: unpublished results). We examined whether PC3 cells responded in the same way. The same vector containing the gene for ß-galactosidase was used as the control for changes in NF-B activity caused by the vector itself. DNA-binding activity of NF-B was measured with a gel-shift assay. Radiation therapy-induced (30 Gy, 3 hours after exposure; Fig. 2, A) and constitutive NF-B activity was dramatically decreased in PC3 cells transduced with the IB super-repressor gene but not in cells transduced with the ß-galactosidase gene 48 hours after transduction (Fig. 2, B).

View larger version (80K): [in this window] [in a new window]   Fig. 2. A) Gel-shift experiment with cytosolic extracts of PC3 prostate cancer cells 48 hours after inhibition of NF-B activity by transduction of an IB superrepressor gene. Fifteen micrograms of protein was used for each lane. Negative (neg.) control cells with unlabeled oligonucleotide in a 50-fold excess (lane 1), control cells (lane 2), and cells transduced with Ad5-IkB vector (lane 3) are shown as well as control cells (lane 4) and Ad5-IkB-transduced cells (lane 5) 3 hours after a 30-Gy irradiation. B) The IB super-repressor gene product inhibits radiation-induced NF-B activation. Control cells (lane 1), cells transduced with control Ad5-LacZ vector (lane 2), and cells transduced with Ad5-IkB vector (lane 3) are shown. The mutated IB gene product decreases constitutive NF-B activity, whereas the control vector has no effect. n.s. = nonspecific; oligo = oligonucleotide.

 
To study whether activation of the NF-B survival pathway alters the radiation response of cancer cells, we exposed PC3 and HD-MyZ cells to 0-8 Gy of ionizing irradiation and measured clonogenic survival in a colony-forming assay. Transduction of either cell line with Ad5-LacZ and Ad5-IkB did not change the sensitivity of these cells to radiation therapy. There was no statistically significant change in the alpha or beta parameters obtained from a linear-quadratic fit (Fig. 3; Table 1).

View larger version (41K): [in this window] [in a new window]   Fig. 3. Clonogenic survival of PC3 prostate cancer cells (A) (multiplicity of infection [MOI] = 1000) and HD-MyZ Hodgkin's lymphoma cells (B) (MOI = 100) 48 hours after transduction with a gene for the IB super-repressor cells. Cells were irradiated, and 2000-20 000 cells were plated into culture dishes. Transduction with Ad5-LacZ and Ad5-IkB did not alter the sensitivity of PC3 cells and HD-MyZ cells to radiation therapy. SF = surviving fraction. Data are means ± 95% confidence intervals.

 

View this table: [in this window] [in a new window]   Table 1. Radiobiologic parameters*

 
Even though ionizing radiation has been repeatedly reported to activate NF-B (15-18), the role of this pathway in preventing radiation-induced cell death is less clear. Jung et al. (9) reported that inhibition of NF-B activation in cells derived from a patient with ataxia telangiectasia group D by transfection with an IB that cannot be phosphorylated restored normal sensitivity to radiation therapy. In contrast, other groups have shown that activation of NF-B protects against apoptosis induced by chemotherapy, tumor necrosis factor-, or ionizing irradiation in several different cell types (6-8). Nakshatri et al. (19) showed that loss of hormone dependency and progression to a more aggressive tumor phenotype coincides with constitutive activation of NF-B in breast cancer. Another study (20) reported that activation of this pathway is related to chemotherapy resistance.

So far, there has been only one report describing a possible relationship between NF-B activity and the intrinsic radiosensitivity of human cancer cells (21). In that study, the authors selected cell clones from p53-negative glioma cell lines with high-level expression of wild-type IB messenger RNA after transfection with an expression plasmid for this gene. Inconsistently, only two of the clones that were selected had both high IB protein levels and increased sensitivity to radiation therapy. The possibility of selection of radiosensitive clones rather than IB-related radiosensitization cannot be excluded as an explanation for these findings.

In this study, we used an adenoviral vector to insert a gene for the IB super-repressor into PC3 prostate cancer cells and HD-MyZ Hodgkin's lymphoma cells; this IB has been shown to efficiently inhibit constitutive, radiation therapy-induced, and tumor necrosis factor--induced activation of NF-B (Pajonk F, Pajonk K, McBride WH: unpublished data). Both cell lines most likely carry a mutated p53. Transduction rates of more than 99% guaranteed inhibition of NF-B in almost all cells. The data from this study show that radiosensitivity of two human cancer cell lines with high levels of constitutively activated NF-B is not dependent on this pathway. Comparable results were recently reported for NF-B and cytotoxic drugs (22). However, inhibition of NF-B binding to DNA drastically decreased the clonogenicity in both cell lines, emphasizing the importance of NF-B activation for survival of these human cancer cells.

	REFERENCES

Top Abstract Introduction Materials and Methods Results and Discussion References

 

1 Prasad AV, Mohan N, Chandrasekar B, Meltz ML. Induction of transcription of "immediate early genes" by low-dose ionizing radiation. Radiat Res 1995;143:263-72.[ISI][Medline]cancerlit;95380627

2 Weichselbaum RR, Hallahan D, Fuks Z, Kufe D. Radiation induction of immediate early genes: effectors of the radiation-stress response. Int J Radiat Oncol Biol Phys 1994;30:229-34.[ISI][Medline]

3 May MJ, Ghosh S. Signal transduction through NF-kappa B. Immunol Today 1998;19:80-8.[CrossRef][ISI][Medline]cancerlit;98170503

4 Hong JH, Chiang CS, Campbell IL, Sun JR, Withers HR, McBride WH. Induction of acute phase gene expression by brain irradiation. Int J Radiat Oncol Biol Phys 1995;33:619-26.[CrossRef][ISI][Medline]cancerlit;96027774

5 Baeuerle PA, Baltimore D. NF-kappa B: ten years after. Cell 1996;87:13-20.[CrossRef][ISI][Medline]cancerlit;97011134

6 Beg AA, Baltimore D. An essential role for NF-kappaB in preventing TNF-alpha-induced cell death. Science 1996;274:782-4.[Abstract/Free Full Text]cancerlit;97020121

7 Van Antwerp DJ, Martin SJ, Kafri T, Green DR, Verma IM. Suppression of TNF-alpha-induced apoptosis by NF-kappaB. Science 1996;274:787-9.[Abstract/Free Full Text]cancerlit;97020123

8 Wang CY, Mayo MW, Korneluk RG, Goeddel DV, Baldwin AS Jr. NF-kappaB antiapoptosis: induction of TRAF1 and TRAF2 and c-IAP1 and c-IAP2 to suppress caspase-8 activation. Science 1998;281:1680-3.[Abstract/Free Full Text]cancerlit;98404275

9 Jung M, Zhang Y, Lee S, Dritschilo A. Correction of radiation sensitivity in ataxia telangiectasia cells by a truncated I kappa B-alpha. Science 1995;268:1619-21.[Abstract/Free Full Text]cancerlit;95296694

10 Saito Y, Milross CG, Hittelman WN, Li D, Jibu T, Peters LJ, et al. Effect of radiation and paclitaxel on p53 expression in murine tumors sensitive or resistant to apoptosis induction. Int J Radiat Oncol Biol Phys 1997;38:623-31.[CrossRef][ISI][Medline]cancerlit;97375372

11 Meyn RE, Stephens LC, Milas L. Programmed cell death and radioresistance. Cancer Metastasis Rev 1996;15:119-31.[CrossRef][ISI][Medline]cancerlit;96440172

12 Forrester HB, Vidair CA, Albright N, Ling CC, Dewey WC. Using computerized video time lapse for quantifying cell death of X-irradiated rat embryo cells transfected with c-myc or c-Ha-ras. Cancer Res 1999;59:931-9.[Abstract/Free Full Text]cancerlit;99151545

13 Iimuro Y, Nishiura T, Hellerbrand C, Behrns KE, Schoonhoven R, Grisham JW, et al. NFkappaB prevents apoptosis and liver dysfunction during liver regeneration. J Clin Invest 1998;101:802-11.[ISI][Medline]

14 Bargou RC, Leng C, Krappmann D, Emmerich F, Mapara MY, Bommert K, et al. High-level nuclear NF-kappa B and Oct-2 is a common feature of cultured Hodgkin/Reed-Sternberg cells. Blood 1996;87:4340-7.[Abstract/Free Full Text]cancerlit;96220283

15 Li N, Karin M. Ionizing radiation and short wavelength UV activate NF-kappaB through two distinct mechanisms. Proc Natl Acad Sci U S A 1998;95:13012-7.[Abstract/Free Full Text]cancerlit;99007258

16 Lee SJ, Dimtchev A, Lavin MF, Dritschilo A, Jung M. A novel ionizing radiation-induced signaling pathway that activates the transcription factor NF-kappaB. Oncogene 1998;17:1821-6.[CrossRef][ISI][Medline]cancerlit;98449478

17 Raju U, Lu R, Noel F, Gumin GJ, Tofilon PJ. Failure of a second X-ray dose to activate nuclear factor kappaB in normal rat astrocytes. J Biol Chem 1997;272:24624-30.[Abstract/Free Full Text]cancerlit;97450998

18 Valerie K, Laster WS, Kirkham JC, Kuemmerle NB. Ionizing radiation activates nuclear factor kappa B but fails to produce an increase in human immunodeficiency virus gene expression in stably transfected human cells. Biochemistry 1995;34:15768-76.[CrossRef][Medline]cancerlit;96097003

19 Nakshatri H, Bhat-Nakshatri P, Martin DA, Goulet RJ Jr, Sledge GW Jr. Constitutive activation of NF-kappaB during progression of breast cancer to hormone-independent growth. Mol Cell Biol 1997;17:3629-39.[Abstract]cancerlit;97342600

20 Lin ZP, Boller YC, Amer SM, Russell RL, Pacelli KA, Patierno SR, et al. Prevention of brefeldin A-induced resistance to teniposide by the proteasome inhibitor MG-132: involvement of NF-kappaB activation in drug resistance. Cancer Res 1998;58:3059-65.[Abstract/Free Full Text]cancerlit;98343565

21 Yamagishi N, Miyakoshi J, Takebe H. Enhanced radiosensitivity by inhibition of nuclear factor kappa B activation in human malignant glioma cells. Int J Radiat Biol 1997;72:157-62.[CrossRef][ISI][Medline]cancerlit;97414623

22 Bentires-Alj M, Hellin AC, Ameyar M, Chouaib S, Merville MP, Bours V. Stable inhibition of nuclear factor kappaB in cancer cells does not increase sensitivity to cytotoxic drugs. Cancer Res 1999;59:811-5.[Abstract/Free Full Text]cancerlit;99151526

Manuscript received May 9, 1999; revised September 7, 1999; accepted September 20, 1999.

CiteULike    Connotea    Del.icio.us    What's this?

This article has been cited by other articles:

				Z. Wang, N. Cao, D. Nantajit, M. Fan, Y. Liu, and J. J. Li Mitogen-activated Protein Kinase Phosphatase-1 Represses c-Jun NH2-terminal Kinase-mediated Apoptosis via NF-{kappa}B Regulation J. Biol. Chem., July 25, 2008; 283(30): 21011 - 21023. [Abstract] [Full Text] [PDF]

				P. Javvadi, A. T. Segan, S. W. Tuttle, and C. Koumenis The Chemopreventive Agent Curcumin Is a Potent Radiosensitizer of Human Cervical Tumor Cells via Increased Reactive Oxygen Species Production and Overactivation of the Mitogen-Activated Protein Kinase Pathway Mol. Pharmacol., May 1, 2008; 73(5): 1491 - 1501. [Abstract] [Full Text] [PDF]

				G. Sethi, B. Sung, and B. B. Aggarwal Nuclear Factor-{kappa}B Activation: From Bench to Bedside Experimental Biology and Medicine, January 1, 2008; 233(1): 21 - 31. [Abstract] [Full Text] [PDF]

				C. Allen, S. Duffy, T. Teknos, M. Islam, Z. Chen, P. S. Albert, G. Wolf, and C. Van Waes Nuclear Factor-{kappa}B-Related Serum Factors as Longitudinal Biomarkers of Response and Survival in Advanced Oropharyngeal Carcinoma Clin. Cancer Res., June 1, 2007; 13(11): 3182 - 3190. [Abstract] [Full Text] [PDF]

				K. M. Ahmed, S. Dong, M. Fan, and J. J. Li Nuclear Factor-{kappa}B p65 Inhibits Mitogen-Activated Protein Kinase Signaling Pathway in Radioresistant Breast Cancer Cells Mol. Cancer Res., December 1, 2006; 4(12): 945 - 955. [Abstract] [Full Text] [PDF]

				M. Pervan, K. S. Iwamoto, and W. H. McBride Proteasome Structures Affected by Ionizing Radiation Mol. Cancer Res., July 1, 2005; 3(7): 381 - 390. [Abstract] [Full Text] [PDF]

				F. Pajonk, A. van Ophoven, and W. H. McBride Hyperthermia-Induced Proteasome Inhibition and Loss of Androgen Receptor Expression in Human Prostate Cancer Cells Cancer Res., June 1, 2005; 65(11): 4836 - 4843. [Abstract] [Full Text] [PDF]

				L. Farhana, M. I. Dawson, and J. A. Fontana Apoptosis Induction by a Novel Retinoid-Related Molecule Requires Nuclear Factor-{kappa}B Activation Cancer Res., June 1, 2005; 65(11): 4909 - 4917. [Abstract] [Full Text] [PDF]

				T. Wang, Y.-C. Hu, S. Dong, M. Fan, D. Tamae, M. Ozeki, Q. Gao, D. Gius, and J. J. Li Co-activation of ERK, NF-{kappa}B, and GADD45{beta} in Response to Ionizing Radiation J. Biol. Chem., April 1, 2005; 280(13): 12593 - 12601. [Abstract] [Full Text] [PDF]

				W. H. Dragowska, C. Warburton, D. T.T. Yapp, A. I. Minchinton, Y. Hu, D. N. Waterhouse, K. Gelmon, K. Skov, J. Woo, D. Masin, et al. HER-2/neu Overexpression Increases the Viable Hypoxic Cell Population within Solid Tumors without Causing Changes in Tumor Vascularization Mol. Cancer Res., November 1, 2004; 2(11): 606 - 619. [Abstract] [Full Text] [PDF]

				S.-J. Jeong, M. Radonovich, J. N. Brady, and C. A. Pise-Masison HTLV-I Tax induces a novel interaction between p65/RelA and p53 that results in inhibition of p53 transcriptional activity Blood, September 1, 2004; 104(5): 1490 - 1497. [Abstract] [Full Text] [PDF]

				A. Munshi, J. F. Kurland, T. Nishikawa, P. J. Chiao, M. Andreeff, and R. E. Meyn Inhibition of constitutively activated nuclear factor-{kappa}B radiosensitizes human melanoma cells Mol. Cancer Ther., August 1, 2004; 3(8): 985 - 992. [Abstract] [Full Text] [PDF]

				S. Altuwaijri, H.-K. Lin, K.-H. Chuang, W.-J. Lin, S. Yeh, L. A. Hanchett, M. M. Rahman, H.-Y. Kang, M.-Y. Tsai, Y. Zhang, et al. Interruption of Nuclear Factor {kappa}B Signaling by the Androgen Receptor Facilitates 12-O-Tetradecanoylphorbolacetate-Induced Apoptosis in Androgen-sensitive Prostate Cancer LNCaP Cells Cancer Res., November 1, 2003; 63(21): 7106 - 7112. [Abstract] [Full Text] [PDF]

				G. Guo, Y. Yan-Sanders, B. D. Lyn-Cook, T. Wang, D. Tamae, J. Ogi, A. Khaletskiy, Z. Li, C. Weydert, J. A. Longmate, et al. Manganese Superoxide Dismutase-Mediated Gene Expression in Radiation-Induced Adaptive Responses Mol. Cell. Biol., April 1, 2003; 23(7): 2362 - 2378. [Abstract] [Full Text] [PDF]

				F. Pajonk, J. Himmelsbach, K. Riess, A. Sommer, and W. H. McBride The Human Immunodeficiency Virus (HIV)-1 Protease Inhibitor Saquinavir Inhibits Proteasome Function and Causes Apoptosis and Radiosensitization in Non-HIV-associated Human Cancer Cells Cancer Res., September 15, 2002; 62(18): 5230 - 5235. [Abstract] [Full Text] [PDF]

				J. S. Russell, U. Raju, G. J. Gumin, F. F. Lang, D. R. Wilson, T. Huet, and P. J. Tofilon Inhibition of Radiation-induced Nuclear Factor-{kappa}B Activation by an Anti-Ras Single-Chain Antibody Fragment: Lack of Involvement in Radiosensitization Cancer Res., April 1, 2002; 62(8): 2318 - 2326. [Abstract] [Full Text] [PDF]

				X. Chen, B. Shen, L. Xia, A. Khaletzkiy, D. Chu, J. Y. C. Wong, and J.-J. Li Activation of Nuclear Factor {kappa}B in Radioresistance of TP53-inactive Human Keratinocytes Cancer Res., February 1, 2002; 62(4): 1213 - 1221. [Abstract] [Full Text] [PDF]

				G. G. Hillman, J. D. Forman, O. Kucuk, M. Yudelev, R. L. Maughan, J. Rubio, A. Layer, S. Tekyi-Mensah, J. Abrams, and F. H. Sarkar Genistein Potentiates the Radiation Effect on Prostate Carcinoma Cells Clin. Cancer Res., February 1, 2001; 7(2): 382 - 390. [Abstract] [Full Text]

				S. Huang, J. B. Robinson, A. DeGuzman, C. D. Bucana, and I. J. Fidler Blockade of Nuclear Factor-{{kappa}}B Signaling Inhibits Angiogenesis and Tumorigenicity of Human Ovarian Cancer Cells by Suppressing Expression of Vascular Endothelial Growth Factor and Interleukin 8 Cancer Res., October 1, 2000; 60(19): 5334 - 5339. [Abstract] [Full Text]

				H. J. Muenchen, D.-L. Lin, M. A. Walsh, E. T. Keller, and K. J. Pienta Tumor Necrosis Factor-{{alpha}}-induced Apoptosis in Prostate Cancer Cells through Inhibition of Nuclear Factor-{{kappa}}B by an I{{kappa}}B{{alpha}} "Super-Repressor" Clin. Cancer Res., May 1, 2000; 6(5): 1969 - 1977. [Abstract] [Full Text]

				A. Dritschilo Radiosensitivity and Transcription Factor NF-{kappa}B Inhibition--Progress and Pitfalls J Natl Cancer Inst, November 17, 1999; 91(22): 1910 - 1911. [Full Text] [PDF]

				M. Tabata, R. Tabata, D. R. Grabowski, R. M. Bukowski, M. K. Ganapathi, and R. Ganapathi Roles of NF-kappa B and 26 S Proteasome in Apoptotic Cell Death Induced by Topoisomerase I and II Poisons in Human Nonsmall Cell Lung Carcinoma J. Biol. Chem., March 9, 2001; 276(11): 8029 - 8036. [Abstract] [Full Text] [PDF]

This Article Abstract FREE Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Add to My Personal Archive Download to citation manager Request Permissions Google Scholar Articles by Pajonk, F. Articles by McBride, W. H. Search for Related Content PubMed PubMed Citation Articles by Pajonk, F. Articles by McBride, W. H. Social Bookmarking          What's this?

Online ISSN 1460-2105 - Print ISSN 0027-8874

Copyright © 2007 Oxford University Press

Oxford Journals Oxford University Press

• Site Map
• Privacy Policy
• Frequently Asked Questions

Other Oxford University Press sites: Oxford University Press Oxford Journals Japan American National Biography Booksellers' Information Service Children's Fiction and Poetry Children's Reference Corporate & Special Sales Dictionaries Dictionary of National Biography Digital Reference English Language Teaching Higher Education Textbooks Humanities International Education Unit Law Medicine Music Online Products Oxford English Dictionary Reference Rights and Permissions Science School Books Social Sciences Very Short Introductions World's Classics